|
|
||||||||
Articles |
1
Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA 94305;
2
Department of Veterans Affairs Sierra-Pacific Mental Illness Research, Education, and Clinical Center, Palo Alto, CA 94304
aaddress correspondence to this author at: Neuroscience Research Laboratories, Department of Psychiatry and Behavioral Sciences, MSLS P-104, Stanford University School of Medicine, Stanford, CA 94305-5485; fax 650-725-5714, e-mail gmurphy@stanford.edu
| Introduction |
|---|
) into the amplicon using a forward primer with a 3' single-nucleotide mismatch (underlined and in bold). The primers 2D61496F [gcctggacaacttggaagaact; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D61496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon.
The following were mixed with 1 µL of genomic DNA at 0.231.1 µg/µL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 µL: 2.5 µL of 10x PCR buffer (Applied Biosystems);
| Acknowledgments |
|---|
| References |
|---|
The following articles in journals at HighWire Press have cited this article:
![]() |
G. M. Murphy Jr Application of microarray technology in psychotropic drug trials J Psychopharmacol, July 1, 2006; 20(4_suppl): 72 - 78. [Abstract] [PDF] |
||||
![]() |
G. M. Murphy Jr., C. Kremer, H. E. Rodrigues, and A. F. Schatzberg Pharmacogenetics of Antidepressant Medication Intolerance Am J Psychiatry, October 1, 2003; 160(10): 1830 - 1835. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-H. Chou, F.-X. Yan, D. K. Robbins-Weilert, T. B. Ryder, W. W. Liu, C. Perbost, M. Fairchild, J. de Leon, W. H. Koch, and P. J. Wedlund Comparison of Two CYP2D6 Genotyping Methods and Assessment of Genotype-Phenotype Relationships Clin. Chem., April 1, 2003; 49(4): 542 - 551. [Abstract] [Full Text] [PDF] |
||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |