Clinical Chemistry
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 47: 2153-2155, 2001;
This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Claassen, J. D.
Right arrow Articles by Murphy, G. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Claassen, J. D.
Right arrow Articles by Murphy, G. M., Jr
Related Collections
Right arrow Molecular Diagnostics and Genetics
Right arrow Drug Monitoring and Toxicology
Right arrow Automation and Analytical Techniques
(Clinical Chemistry. 2001;47:2153-2155.)
© 2001 American Association for Clinical Chemistry, Inc.


Articles

Rapid Detection of the C-1496G Polymorphism in the CYP2D6 *2 Allele

Jeremy D. Claassen1, Nina Pascoe1,2, Alan F. Schatzberg1 and Greer M. Murphy, Jr1,2a

1 Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA 94305;
2 Department of Veterans Affairs Sierra-Pacific Mental Illness Research, Education, and Clinical Center, Palo Alto, CA 94304

aaddress correspondence to this author at: Neuroscience Research Laboratories, Department of Psychiatry and Behavioral Sciences, MSLS P-104, Stanford University School of Medicine, Stanford, CA 94305-5485; fax 650-725-5714, e-mail gmurphy@stanford.edu


   Introduction
 
The CYP2D6 gene, encoding debrisoquine hydroxylase, is involved in the metabolism of a large number of medications (1). Recently, Raimundo et al. (2) described a C-1496G polymorphism in the promoter region of the CYP2D6 *2 allele that has a strong effect on debrisoquine metabolic phenotype when present in combination with a null allele. The *2 allele is the most common allele encoding intermediate debrisoquine hydroxylase activity in Caucasians (3), but to date, substantial variability among *2 carriers in metabolic activity has been reported. To accurately predict debrisoquine phenotype from CYP2D6 genotype in *2 carriers, determining C-1496G genotype will be necessary. We sought to develop a rapid, high-throughput genotyping assay for the CYP2D6 C-1496G promoter polymorphism described by Raimundo et al. (2). Because no available restriction enzyme differentially digests the polymorphic site (4), we introduced a BsrI restriction site (actggn{wedge}) into the amplicon using a forward primer with a 3' single-nucleotide mismatch (underlined and in bold). The primers 2D6–1496F [gcctggacaacttggaagaact; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D6–1496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon.

The following were mixed with 1 µL of genomic DNA at 0.23–1.1 µg/µL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 µL: 2.5 µL of 10x PCR buffer (Applied Biosystems); . . . [Full Text of this Article]


   Acknowledgments
 

   References
 



The following articles in journals at HighWire Press have cited this article:


Home page
J PsychopharmacolHome page
G. M. Murphy Jr
Application of microarray technology in psychotropic drug trials
J Psychopharmacol, July 1, 2006; 20(4_suppl): 72 - 78.
[Abstract] [PDF]


Home page
Am. J. PsychiatryHome page
G. M. Murphy Jr., C. Kremer, H. E. Rodrigues, and A. F. Schatzberg
Pharmacogenetics of Antidepressant Medication Intolerance
Am J Psychiatry, October 1, 2003; 160(10): 1830 - 1835.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
W.-H. Chou, F.-X. Yan, D. K. Robbins-Weilert, T. B. Ryder, W. W. Liu, C. Perbost, M. Fairchild, J. de Leon, W. H. Koch, and P. J. Wedlund
Comparison of Two CYP2D6 Genotyping Methods and Assessment of Genotype-Phenotype Relationships
Clin. Chem., April 1, 2003; 49(4): 542 - 551.
[Abstract] [Full Text] [PDF]




HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Copyright © 2001 by the American Association for Clinical Chemistry.