HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Full Text Full Text (PDF) Submit an electronic Letter to the Editor about this paper Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (4) Citing Articles via Google Scholar Google Scholar Articles by Claassen, J. D. Articles by Murphy, G. M. Search for Related Content PubMed PubMed Citation Articles by Claassen, J. D. Articles by Murphy, G. M., Jr Related Collections Molecular Diagnostics and Genetics Drug Monitoring and Toxicology Automation and Analytical Techniques

Rapid Detection of the C-1496G Polymorphism in the CYP2D6 *2 Allele

¹ Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA 94305;
² Department of Veterans Affairs Sierra-Pacific Mental Illness Research, Education, and Clinical Center, Palo Alto, CA 94304

^aaddress correspondence to this author at: Neuroscience Research Laboratories, Department of Psychiatry and Behavioral Sciences, MSLS P-104, Stanford University School of Medicine, Stanford, CA 94305-5485; fax 650-725-5714, e-mail gmurphy@stanford.edu

	Introduction

 
The CYP2D6 gene, encoding debrisoquine hydroxylase, is involved in the metabolism of a large number of medications (1). Recently, Raimundo et al. (2) described a C-1496G polymorphism in the promoter region of the CYP2D6 *2 allele that has a strong effect on debrisoquine metabolic phenotype when present in combination with a null allele. The *2 allele is the most common allele encoding intermediate debrisoquine hydroxylase activity in Caucasians (3), but to date, substantial variability among *2 carriers in metabolic activity has been reported. To accurately predict debrisoquine phenotype from CYP2D6 genotype in *2 carriers, determining C-1496G genotype will be necessary. We sought to develop a rapid, high-throughput genotyping assay for the CYP2D6 C-1496G promoter polymorphism described by Raimundo et al. (2). Because no available restriction enzyme differentially digests the polymorphic site (4), we introduced a BsrI restriction site (actggn) into the amplicon using a forward primer with a 3' single-nucleotide mismatch (underlined and in bold). The primers 2D6–1496F [gcctggacaacttggaagaact; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D6–1496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon.

The following were mixed with 1 µL of genomic DNA at 0.23–1.1 µg/µL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 µL: 2.5 µL of 10x PCR buffer (Applied Biosystems); . . . [Full Text of this Article]

	Acknowledgments

 

	References

 

The following articles in journals at HighWire Press have cited this article:

				G. M. Murphy Jr Application of microarray technology in psychotropic drug trials. J Psychopharmacol, July 1, 2006; 20(4 Suppl): 72 - 78. [Abstract] [PDF]

				G. M. Murphy Jr., C. Kremer, H. E. Rodrigues, and A. F. Schatzberg Pharmacogenetics of Antidepressant Medication Intolerance Am J Psychiatry, October 1, 2003; 160(10): 1830 - 1835. [Abstract] [Full Text] [PDF]

				W.-H. Chou, F.-X. Yan, D. K. Robbins-Weilert, T. B. Ryder, W. W. Liu, C. Perbost, M. Fairchild, J. de Leon, W. H. Koch, and P. J. Wedlund Comparison of Two CYP2D6 Genotyping Methods and Assessment of Genotype-Phenotype Relationships Clin. Chem., April 1, 2003; 49(4): 542 - 551. [Abstract] [Full Text] [PDF]