Clinical Chemistry Link to Randox Laboratories Web Site
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 50: 1814-1817, 2004; 10.1373/clinchem.2004.034363
This Article
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Submit an electronic Letter to
the Editor about this paper
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Germi, R.
Right arrow Articles by Seigneurin, J.-M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Germi, R.
Right arrow Articles by Seigneurin, J.-M.
Related Collections
Right arrow Molecular Diagnostics and Genetics
(Clinical Chemistry. 2004;50:1814-1817.)
© 2004 American Association for Clinical Chemistry, Inc.


Technical Briefs

Quantification of gp350/220 Epstein–Barr Virus (EBV) mRNA by Real-Time Reverse Transcription-PCR in EBV-Associated Diseases

Raphaële Germi1,1,a, Patrice Morand1,2,1, Karen Brengel-Pesce1, Samira Fafi-Kremer1,2, Odile Genoulaz1, Christophe Ginevra1, Mirvat Ballout1, Gérard Barguès2 and Jean-Marie Seigneurin1,2

1 Laboratoire de Virologie Moléculaire et Structurale, Faculté de Médecine, Université Joseph Fourier, Grenoble, France;
2 Département de Virologie Centre Hospitalier Universitaire, Grenoble, France;

aaddress correspondence to this author at: Laboratoire de Virologie Moléculaire et Structurale, Faculté de Médecine, Université Joseph Fourier, BP 53, 38041 Grenoble, France; fax 33-476548074, e-mail raphaele.germi@ujf-grenoble.fr

The first 300 words of the full text of this article appear below.

Quantification of the Epstein–Barr (EBV) DNA genome by quantitative real-time PCR has been useful for the management of EBV-associated diseases (1)(2)(3)(4). Nevertheless, it gives no information on the various patterns of expression of the latent genes or on the presence of a lytic infection. EBV lytic mRNAs have been detected in infectious mononucleosis and some EBV-associated malignancies, but their relevance is still debated (5)(6)(7). The quantification of late EBV transcripts may bring additional information to EBV DNA quantification for the understanding and follow-up of EBV-associated disease, as already demonstrated for other herpes viruses (8)(9)(10)(11).

In this study, we developed a method for quantifying a late transcript of the highly conserved EBV envelope glycoprotein gene, gp350/220 (12)(13), that uses real-time reverse transcription-PCR (RT-PCR), the Taqman® technology, and serial dilutions of in vitro transcripts to quantify mRNA. gp350/220 mRNA was quantified in EBV-infected cell lines and was then applied to a series of clinical samples.

Total RNA from cell lines (500 000 cells), clinical samples, or in vitro transcripts (5 µL) was extracted with the High-Pure-RNA-Isolation-Kit® (Roche), and residual DNA was removed by two 20-min incubations with DNase I. The RNA concentration was estimated spectrophotometrically and converted to copy number for the in vitro transcript.

The RT-PCR mixture (20 µL) contained 100 ng of total RNA from cell lines or 250 ng of total RNA from clinical samples, 3.25 mM manganese acetate (LightCycler-RNA-Master-Hybridization-Probes-Kit®; Roche), 0.3 µM upstream primer [gpU2; 5'-AGAATCTGGGCTGGGACGTT-3'; position 89585 (14)], 0.3 µM downstream primer (gpL2; 5'-ACATGGAGCCCGGACAAGT-3'; position 89784), and 0.3 µM probe [EBVGPq; 5'-(6-FAM)AGCCCACCACAGATTACGGCGGT(TAMRA)(Phosphate)-3', where 6-FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine; position 89761]. The RT-PCR program (61 °C for 30 . . . [Full Text of this Article]







HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Copyright © 2004 by the American Association for Clinical Chemistry.