Clinical Chemistry 43: 279-284, 1997;
(Clinical Chemistry. 1997;43:279-284.)
© 1997 American Association for Clinical Chemistry, Inc.
Human prostate-specific glandular kallikrein is expressed as an active and an inactive protein
Annakaisa Herrala,
Riitta Kurkela,
Katja Porvari,
Ritva Isomäki,
Pirkko Henttu and
Pirkko Vihkoa
Biocenter Oulu and Department of Clinical Chemistry, University of Oulu, Kajaanintie 50, FIN-90220 Oulu, Finland.
a Author for correspondence. Fax 358-8-3154451; e-mail pvihko{at}whoccr.oulu.fi
 |
Abstract
|
|---|
A polymorphism in the human prostate-specific glandular kallikrein
(hKLK2) gene was described by direct sequencing (by PCR) of
genomic DNAs isolated from prostatic cancer tissue, benign prostatic
hyperplasia tissue, and blood leukocyte specimens. Results showed two
forms of human prostate-specific glandular kallikrein protein (hK2), a
consequence of a change from C to T at base 792 in the hK2 coding
region. Producing the two forms as recombinant proteins in insect cells
demonstrated that Arg226-hK2 (CC genotype) is an active
protein and Trp226-hK2 (TT genotype) is inactive.
Polymorphism studies of 36 patients with prostatic diseases identified
only 1 with the TT genotype. The same kind of polymorphism was not
detected in the human prostate-specific antigen (hKLK3)
gene. Arg226-hK2 possessed only trypsin-like enzyme
activity, whereas recombinant human prostate-specific antigen (hPSA)
had only chymotrypsin-like activity. Monoclonal and polyclonal
antibodies raised against hPSA purified from seminal plasma detected
both active and inactive hK2. Thus, because inactive as well as stable
hK2 protein may be present, a lack of trypsin-like activity in hPSA
standards is not enough to confirm that the materials are free of hK2
contamination.
Key Words: indexing terms: prostate-specific antigen prostatic cancer recombinant protein allelic frequency polymorphism enzyme activity purification of assay components
 |
Introduction
|
|---|
The human glandular kallikrein gene family comprises three
different genes: prostate-specific antigen (hKLK3),
prostate-specific glandular kallikrein (hKLK2), and
pancreatic/renal kallikrein (hKLK1) genes
(1).1
All three kallikrein genes are located on chromosome 19, and
hKLK3 and hKLK2 are aligned 12 kb apart
(2)(3)(4). The similarity of the coding region of the
hKLK1 gene and that of the hKLK3 and
hKLK2 genes is 74% and 75%, respectively. Moreover, the
coding regions of hKLK3 and hKLK2 are 85%
identical, and 91% of their promoter regions are the same
(5)(6). hKLK1 encodes tissue
kallikrein, shows kininogenase activity, and is expressed in kidneys,
pancreas, and salivary glands (7)(8)(9). In situ
hybridization has shown that hKLK3 and hKLK2 are
expressed only in prostatic epithelial cells (10)(11)(12)(13)(14). As
tested in LNCaP cells, the presence of androgens has a clear
up-regulation effect on the amounts of hKLK2 and hKLK3 mRNA
(15).
Recently, the prostate-specificity of hKLK2 and
hKLK3 gene expression has been questioned. The expression of
all three human kallikrein genes in human endometrium has been detected
by reverse transcription-PCR (16). Human prostate-specific
antigen (hPSA) has been detected in the milk of lactating women by hPSA
immunoassay (17). In addition, 3040% of breast tumors
and steroid hormone-stimulated normal breast tissue produce low amounts
of hPSA (18)(19)(20)(21).
The nucleotide sequence of the five coding exons of hKLK2
predicts the production of a 261-amino acid preproprotein that includes
a signal peptide of 17 amino acids and an activation peptide of 7 amino
acids, similar to the structure of hPSA (22). Human
prostate-specific glandular kallikrein (hK2) possess the catalytic
triad (His41Asp96Ser189)
typical of serine proteases; moreover, the presence of
Asp183 in hK2 predicts a trypsin-like activity towards
substrate, although the function of hK2 is unknown. In contrast, hPSA
has a serine residue at this position, which apparently confers
chymotrypsin-like activity (23)(24). The
function of hPSA is to cleave the semenogelin clot; it also digests
insulin-like growth factor (IGF)-binding protein-3
(25)(26).
Serum concentrations of hPSA are increased in patients with cancerous
and benign hyperplastic prostatic tissues, and this protein is widely
used as a tumor marker for detecting and monitoring prostatic cancer
(27)(28). Because of the high homology between
hKLK3 and hKLK2, it may be difficult to purify
the hK2 and the hPSA proteins separately (29).
Furthermore, the close similarity of these proteins could cause
cross-reactivity between hK2 and hPSA as antigens
(30)2
. The hK2 protein remains to be adequately purified, and the
purity of hPSA is not always unambiguous. Problems of antigen purity
could lead to complications in hPSA assays that are based on polyclonal
or monoclonal antibodies raised against hPSA purified from seminal
fluid. Here we report our production and characterization of two
polymorphic forms of hK2 protein that are detectable by the monoclonal
and polyclonal antibodies raised against hPSA purified from seminal
plasma (28).
 |
Materials and Methods
|
|---|
Cloning hK2 cDNAs.
The hK2 coding sequence was amplified
by PCR from the human prostatic cancer tissue cDNA library (Clontech,
Palo Alto, CA). For PCR, the N-terminal oligomer,
5'-TCCCCCGGGAGATCTCACCATGTGGGACCTGGTTCTC-3', contained
SmaI and BglII restriction sites, whereas the
C-terminal oligomer,
5'-CGCTCTAGATCAGGGGTTGG-CTGCGATGGT-3',
contained a XbaI restriction site in addition to the
hK2 coding sequences. (Nucleotides that differ between hK2 and hPSA are
shown in bold type, whereas underlining indicates
identical nucleotides in the C-terminal oligomers.) The hK2 PCR product
was cloned into PCRII-vector (Invitrogen, San Diego, CA), and both
strands of the insert were sequenced (31). This hK2 cDNA
contained T nucleotide at position 792, which leads to the amino acid
change from originally reported Arg226 (22) to
Trp226 and suggests possible polymorphism in the
hKLK2 gene.
Another hK2 cDNA was generated by using PCR with the N-terminal
oligomer described above and a longer C-terminal oligomer,
5'-CCCGGGATCAGGGGTTGGCTGCGATGGTGTCCTGATCCACTTCCGGTAATGCACC3';
this sequence replaced T nucleotide with C at the position 792
(surrounded by asterisks), which codes for Arg226 in hK2
protein. The sequence of this cDNA was also confirmed from both
directions.
Detections of the Arg226/Trp226polymorphism.
Genomic DNA was isolated from prostatic tissue
obtained by prostatectomy, biopsy, or transurethral resection and from
blood leukocytes (32). Female and young male blood
leukocyte DNAs were used as a control material. The 5' oligomer
(5'-TTCTCACTGTGTCTCTCCTCC-3') and the biotin-labeled 3' oligomer
(5'-GTGGGACAGGGGCACTCA-3') were used to amplify the hKLK2
gene region from nucleotide 4942 in intron 4 to nucleotide 5144 in exon
5. The PCR products were sequenced (33) by using the
fluorescein amidite-labeled oligomer 5'-ATCATGGGG-CCCTGAGCC-3', which
corresponds to the region of nucleotides 5023 to 5041 in exon 5. The
products were electrophoresed under standard conditions with the
Automated Laser Fluorescent DNA Sequencer (Pharmacia LKB Biotechnology,
Uppsala, Sweden), as recommended by the manufacturer.
Construction of recombinant plasmid pVL1392 transfer vectors
and generation of recombinant hK2 baculoviruses.
The hK2 cDNAs
were subcloned into the BglII/XbaI site of the
pVL1392 transfer vectors (Invitrogen). The pVL1392 transfer vectors
containing either of the hK2 cDNA fragments, confirmed by sequencing,
were cotransfected with linearized wild-type BaculoGold-DNA
(Pharmingen, San Diego, CA) into Spodoptera frugiperda (Sf9)
insect cells (CRL1711; ATCC, Rockville, MD) (34).
Production and
purification of recombinant
Arg226-hK2 and
Trp226-hK2. The recombinant hK2 proteins
were produced on a pilot scale with 2-L (Biostat MD) and 30-L (Biostat
UD30) bioreactors (B. Braun Biotech International, Melsungen, Germany)
(35). The harvested medium from the recombinant virus
infection was concentrated with a Pellicon cassette system (10-kDa
cutoff; Millipore, Bedford, MA) and dialyzed into 50 mmol/L sodium
acetate buffer (pH 5.5). The concentrate was loaded onto a 3.5 x
10 cm cation-exchange column (S-Sepharose HP; Pharmacia), the column
was washed, and the recombinant hK2 protein was eluted with a linear
NaCl gradient (0250 mmol/L). The fractions that were immunoreactive
with polyclonal hPSA antibody were concentrated (with a concentrator
from Amicon, Beverly, MA) for gel-filtration chromatography through a
2.6 x 80 cm column of Superdex 75 (Pharmacia), from which they
were eluted with 50 mmol/L sodium acetate (pH 5.8) containing 150
mmol/L NaCl. The hK2-containing fractions were pooled and dialyzed in
50 mmol/L sodium acetate (pH 5.8) for cation-exchange chromatography
through a 0.5 x 5.0 cm Mono-S HR column (Pharmacia). The
recombinant hK2 protein was eluted from the column with a linear NaCl
gradient (0200 mmol/L). The S-Sepharose and the Superdex 75 columns
were connected to a BioPilot automated chromatography system; the
Mono-S column was used with the FPLC system (all from Pharmacia).
Characterization of recombinant
Arg
226-hK2 and
Trp226-hK2. The purity and characterization
of recombinant hK2 proteins were evaluated by sodium dodecyl
sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) and nonreducing
PAGE. Both types of electrophoresis were carried out on a PhastSystem
(Pharmacia) with PhastGel gradient media 1015 for SDS-PAGE and 825
for nonreducing PAGE, and the products were silver-stained
(36)(37)(38)(39)(40). For Western blotting, the proteins were
transferred onto nitrocellulose membranes with PhastTransfer
(Pharmacia) (41). Rabbit polyclonal antibody raised
against hPSA purified from seminal fluid (28) was used
with a ProtoBlot AP system (Promega, Madison, WI) to detect the
expressed protein. In both electrophoresis procedures, the recombinant
hK2 proteins were always compared with commercial hPSA purified from
seminal fluid (Calbiochem, La Jolla, CA).
To determine the nature of the isolated recombinant hK2, we assessed
its ability to hydrolyze Pro-Phe-Arg-p-nitroanilide (pNA)
(which would demonstrate trypsin-like activity) and Arg-Pro-Tyr-pNA
(for chymotrypsin-like activity), both from Chromogenix (Mölndal,
Sweden), at a final concentration of 1 mmol/L. The reactions, performed
at 37 °C, were initiated by adding 50 µL of the chromogenic
substrate to 200 µL of 50 mmol/L sodium phosphate buffer (pH 7.8)
containing 100 mmol/L NaCl and hK2. After 1 h, the reaction was
stopped by adding 800 µL of 0.6 mol/L acetic acid, and the absorbance
of the reaction mixture was measured at 405 nm (42). The
reaction rate, nanomoles of pNA formed per minute, was calculated from
the calibration curve for pNA. The same reactions were also carried out
with recombinant hPSA (43).
 |
Results
|
|---|
detection of the arg226/trp226
polymorphism
The coding region of the hK2 cDNA was amplified from the human
prostatic cancer tissue cDNA library by PCR. The hK2 cDNA sequence from
this prostatic cancer tissue library had one base different from that
reported earlier (22). The difference at base 792 (C vs T)
results in production of different amino acids at residue 226,
Arg226 and Trp226, respectively. Sequenced DNA
samples from both tissue and leukocyte specimens from 36 patients with
prostatic diseases revealed a polymorphism at this base position (Table 1
and Fig. 1
). In this limited specimen material, 13 of 24 patients with
prostatic cancer were heterozygotes (CT), 10 were homozygotes (CC), and
1 was a homozygote (TT). Genotypes of sequenced specimens from the
other groups are summarized in Table 1
, as are the frequencies of the
Arg226 and Trp226 alleles. When the respective
region of the hKLK3 gene was sequenced from the same genomic
DNA specimens, only CC homozygotes were detected at base position 792.

View larger version (104K):
[in this window]
[in a new window]
|
Figure 1. Detection of polymorphism at base 792 in hKLK2
gene.
Genomic sequences from three DNA specimens showing homozygous CC
(top chart), heterozygous CT (middle chart), and
homozygous TT forms (bottom chart).
|
|
production and characterization of recombinant
arg226-hk2 and trp226-hk2
Arg226-hK2 and Trp226-hK2 were
produced for the first time as mature proteins by use of a baculovirus
expression vector system in Sf9 cells. Production with the
Trp226 construct was ~300-fold that with the
Arg226-construct.
To evaluate the purity of the recombinant Trp226-hK2
and Arg226-hK2 proteins, we used SDS-PAGE and nonreducing
PAGE and either silver-staining or immunostaining with hPSA antibodies.
In reduced SDS-PAGE (Fig. 2
, B and D), the molecular masses of Trp226-hK2 and
Arg226-hK2 were 33 kDa, whereas that of commercial hPSA was
34 kDa. An analysis of the recombinant Trp226-hK2 with
ion-spray mass spectrometry showed an average mass of 27.4 kDa. In
silver-stained nonreducing PAGE (Fig. 2A
), recombinant
Trp226-hK2 showed one band, whereas commercial hPSA had
four bands. In immunostained nonreducing PAGE (Fig. 2C
),
Arg226-hK2 showed two bands, which moved farther than the
broad band for Trp226-hK2. When digested with N-
and O-glycosidase enzymes, neither hK2 form showed a
detectable change in molecular mass (data not shown).

View larger version (38K):
[in this window]
[in a new window]
|
Figure 2. Silver-stained polyacrylamide gel electrophoreses and
immunoblot analyses of recombinant hK2 proteins.
Top panels: Pure recombinant Trp226-hK2 protein
(lane 1) and commercial hPSA (lane 2) were
silver-stained in native (A) and reduced SDS-PAGE
(B) analyses. Lower panels: Rabbit polyclonal
antibody raised against hPSA purified from seminal fluid was used to
detect recombinant Arg226-hK2 (lane 1),
recombinant Trp226-hK2 (lane 2), and commercial
hPSA (lane 3) on immunoblotted native PAGE (C)
and reduced SDS-PAGE (D).
|
|
Activity measurements showed that Arg226-hK2 had
trypsin-like but not chymotrypsin-like activity, its specific activity
(per milligram) being 320.6 nmol/min when measured with the
Pro-Phe-Arg-pNA synthetic peptide. Trp226-hK2, however, had
no detectable trypsin- or chymotrypsin-like activity. The recombinant
hPSA had chymotrypsin-like but not trypsin-like activity
(43).
 |
Discussion
|
|---|
We have identified polymorphism in the hKLK2 gene. A
nucleotide change from C to T at a base 792 in hK2 cDNA leads to two
different hK2 proteins, active Arg226-hK2 and inactive
Trp226-hK2. The frequency of the Arg226-allele is about
twice that of the Trp226-allele among 36 patients with prostatic
diseases. The same kind of polymorphism was not detectable in the hKLK3
gene.
To obtain hK2 free of hPSA contamination, we produced the hK2 as a
recombinant protein, using a baculovirus expression vector system in
insect cells. The inactive recombinant Trp226-hK2 was
stable, but the active recombinant Arg226-hK2 protein
seemed to be labile, which might account for its low production yields.
hK2 (CC genotype) has been previously expressed as an inactive
prepropolypeptide in an Escherichia coli system
(30). SDS-PAGE run under reducing conditions showed that
the molecular masses for both of the expressed, nonglycosylated
recombinant hK2 proteins was 33 kDa. The molecular mass of natural,
glycosylated hK2 proteins is probably closer to that of hPSA, 34 kDa.
The amino acid change from Arg226 to
Trp226 affects the net charge of the protein and could
account for the difference in mobility of the hK2 forms in nonreducing
PAGE. Arg226-hK2 showed two bands, possibly from
oligomerization of the protein. Both forms of hK2 were less
heterogeneous in nonreducing PAGE than was commercial hPSA purified
from seminal fluid. The Arg226-hK2 had only trypsin-like
activity when synthetic peptide substrates were used, differing, as
expected, from the chymotrypsin-like activity of hPSA. The
heterogeneity seen in commercial hPSA purified from seminal fluid
possibly results from endoproteolytic cleavage of the protein into two
or four polypeptide chains that are held together by disulfide bridges
(24). The recent results (29) obtained by
mass spectroscopy indicate molecular mass differences between hPSA
isoforms. Some of these differences are probably the results of
differences in glycosylation or the sialic acid content of hPSA
(44).
Protease inhibitors and internal peptide bond cleavages are known
mechanisms for inactivating hPSA. For example, of the hPSA isolated
from seminal fluid, 30% does not have any catalytic activity because
of the internal peptide bond cleavage between Lys145
and Lys146 (45). Possible mechanisms for
inactivation of hK2 are not known. The Arg226 in hK2 is
located in an area that is highly similar between the hK2 and hPSA
proteins, but the inactivating mutation to Trp226 was not
found in hPSA.
The existence of inactive and stabile hK2 enzyme makes questionable the
purity of currently used hPSA standards. Previously,
aprotininSepharose affinity chromatography, based on the trypsin-like
activity of hK2, has been used to remove contaminating hK2 from PSA
samples (14). The lack of trypsin-like activity and
confirmation of the N-terminal sequence of hPSA as described in a
recently published method for rapid hPSA purification (46)
are not sufficient to guarantee the absence of inactive hK2
contamination, because the first 16 N-terminal amino acids of hK2 and
hPSA are identical (23)(24). Moreover,
aprotinin affinity chromatography was not able to remove the
trypsin-like activity of hPSA purified from seminal fluid
(47). Unresolved is whether that hPSA was contaminated
with Arg226-hK2 or whether Trp226-hK2 can be
self-activated. Recombinant protein technology is probably the only
sure way to get pure hPSA for standardizing hPSA assays
(43).
In closing, we note that the purified recombinant hK2 proteins
have been used as antigens for production of monoclonal antibodies to
be used in further studies of the function and expression of active and
inactive hK2 proteins and of the relations of these proteins to
prostatic diseases. We also plan to screen the commercially available
hPSA assays for possible cross-reactivity with active and inactive hK2
proteins.
 |
Acknowledgments
|
|---|
We thank Ulrich Bergmann from the Department of Biochemistry at the
University of Oulu for the ion mass spectrometry analysis. We also
thank Mirja Mäkeläinen, Marja-Liisa Norrena, and Pirkko
Ruokojärvi for their expert technical assistance. The study was
mainly supported by the Research Council for Medicine of the Academy of
Finland. The Department of Clinical Chemistry, University of Oulu, is a
WHO Collaborating Centre for Research in Human Reproduction, supported
by the Ministeries of Education, Health and Social Affairs, and Foreign
Affairs, Finland.
 |
Footnotes
|
|---|
1 Nonstandard abbreviations: hKLK3, human prostate-specific antigen gene; hKLK2, human prostate-specific glandular kallikrein gene; hKLK1, human pancreatic/renal kallikrein gene; hK2, human prostate-specific glandular kallikrein; hPSA, human prostate-specific antigen; SDS-PAGE, sodium dodecyl sulfatepolyacrylamide gel electrophoresis; and pNA, p-nitroanilide. 
2 Worthington KF, Heavner GA, Gero EJ, McCabe RP. Identification of antigenic determinants on PSA and the implications for the interpretation of diagnostic assays for serum PSA levels [Abstract]. Int Symp on Recent Advances in Diagnosis and Treatment of Prostate Cancer, Quebec City, 1995. 
 |
References
|
|---|
-
Clements JA. The glandular kallikrein family of enzymes: tissue-specific expression and hormonal regulation. Endocrine Rev 1989;10:393-419.
[Abstract/Free Full Text]
-
Evans BA, Yun ZX, Close JA, Tregear GW, Kitamura N, Nakanishi S, et al. Structure and chromosomal localization of the human renal kallikrein gene. Biochemistry 1988;27:3124-3129.
[Medline]
[Order article via Infotrieve]
-
Riegman PHJ, Vliestra RJ, Klaassen P, van der Korput JAGM, Romijn JC, Trapman J. The prostate specific antigen gene and the human glandular kallikrein-1 gene are tandemly located on chromosome 19. FEBS Lett 1989;247:123-126.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Riegman PHJ, Vliestra RJ, Suurmeijer L, Cleutjens CB, Trapman J. Characterization of the human kallikrein locus. Genomics 1992;14:6-11.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Henttu P, Vihko P. cDNA coding for the entire human prostate specific antigen shows high homologies to the human tissue kallikrein genes. Biochem Biophys Res Commun 1989;160:903-910.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Henttu P, Vihko P. Prostate-specific antigen and human glandular kallikrein: two kallikreins of the human prostate. Ann Med 1994;26:157-164.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Baker AR, Shine J. Human kidney kallikrein: cDNA cloning and sequence analysis. DNA 1985;4:445-450.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Fukushima D, Kitamura N, Nakanishi S. Nucleotide sequence of cloned cDNA from human pancreatic kallikrein. Biochemistry 1985;24:8037-8043.
[Medline]
[Order article via Infotrieve]
-
Angermann A, Bergmann C, Appelhans H. Cloning and expression of human salivary-gland kallikrein in Escherichia coli. Biochem J 1989;262:787-793.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Chapdelaine P, Paradis G, Tremblay RR, Dubé JY. High level of expression in the prostate of a human glandular kallikrein mRNA related to prostate-specific antigen. FEBS Lett 1988;236:205-208.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Qiu S-D, Young CY-F, Bilhartz DL, Prescott JL, Farrow GM, He W-W, Tindall DJ. In situ hybridization of prostate-specific antigen mRNA in human prostate. J Urol 1990;144:1550-1556.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Young CY-F, Andrews PE, Montgomery BT, Tindall DJ. Tissue-specific and hormonal regulation of human prostate-specific glandular kallikrein. Biochemistry 1992;31:818-824.
[Medline]
[Order article via Infotrieve]
-
Hakalahti L, Vihko P, Henttu P, Autio-Harmainen H, Soini Y, Vihko R. Evaluation of PAP and PSA gene expression in prostatic hyperplasia and prostatic cancer using Northern-blot analyses, in situ hybridization and immunohistochemical stainings with monoclonal and bispecific antibodies. Int J Cancer 1993;55:590-597.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Henttu P, Liao S, Vihko P. Androgens up-regulate the human prostate-specific antigen messenger ribonucleic acid (mRNA), but down-regulate the prostatic acid phosphatase mRNA in the LNCap cell line. Endocrinology 1992;130:766-772.
[Abstract/Free Full Text]
-
Henttu P, Vihko P. Growth factor regulation of gene expression in the human prostatic cancer cell line LNCaP. Cancer Res 1993;53:1051-1058.
[Abstract/Free Full Text]
-
Clements J, Mukhtar A. Glandular kallikreins and prostate-specific antigen are expressed in the human endometrium. J Clin Endocrinol Metab 1994;78:1536-1539.
[Abstract]
-
Yu H, Diamandis EP. Prostate-specific antigen in milk of lactating women. Clin Chem 1995;41:54-58.
[Abstract/Free Full Text]
-
Yu D, Diamandis EP, Sutherland DJA. Immunoreactive prostate specific antigen levels in female and male breast tumors and its association with steroid hormone receptors and patient age. Clin Biochem 1994;27:75-79.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Yu H, Diamandis EP, Nostratollah Z, Grass L. Induction of prostate specific antigen production by steroids and tamoxifen in breast cancer cell lines. Breast Cancer Res Treat 1994;32:291-300.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Diamandis EP, Yu H, Sutherland DJA. Detection of prostate-specific antigen immunoreactivity in breast tumors. Breast Cancer Res Treat 1994;32:301-310.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Yu H, Diamandis EP, Monne M, Croce CM. Oral contraceptive-induced expression of prostate-specific antigen in the female breast. J Biol Chem 1995;270:6615-6618.
[Abstract/Free Full Text]
-
Schedlich L, Bennets BH, Morris BJ. Primary structure of a human glandular kallikrein gene. DNA 1987;6:429-437.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Schaller J, Akiyama K, Tsuda R, Hara M, Marti T, Rickli EE. Isolation, characterization and amino-acid sequence of
-seminoprotein, a glycoprotein from human seminal plasma. Eur J Biochem 1987;170:111-120.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Watt KWK, Lee P-J, M'Timkulu T, Chan W-P, Loor R. Human prostate-specific antigen: structural and funtional similarity with serine proteases. Proc Natl Acad Sci U S A 1986;83:3166-3170.
[Abstract/Free Full Text]
-
Lilja H. A kallikrein-like serine protease in prostatic fluid cleaves the predominant seminal vesicle protein. J Clin Invest 1985;76:1899-1903.
-
Cohen P, Graves HCB, Peehl DM, Kamarei M, Giudice LC, Rosenfeld RG. Prostate-specific antigen (PSA) is an insulin-like growth factor binding protein-3 protease found in seminal plasma. J Clin Endocrinol Metab 1992;75:1046-1053.
[Abstract]
-
Stamey TA, Yang N, Hay AR, McNeal JE, Freiha FS, Redwine E. Prostatic-specific antigen as a serum marker for adenocancer of the prostate. N Engl J Med 1987;317:909-916.
[Abstract]
-
Vihko P, Kurkela R, Ramberg J, Pelkonen I, Vihko R. Time-resolved immunofluorometric assay of human prostate-specific antigen. Clin Chem 1990;36:92-95.
[Abstract/Free Full Text]
-
Bélanger A, van Halbeek H, Graves HCB, Grandbois K, Stamey TA, Huang L, et al. Molecular mass and carbohydrate structure of prostate specific antigen: studies for establishment of an international PSA standard. Prostate 1995;27:187-197.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Saedi MS, Gass MMJ, Goel AS, Grauer L, Hogen KL, Okaneya T, et al. Overexpression of human prostate-specific glandular kallikrein, hK2, in E. coli and generation of antibodies. Mol Cell Endocrinol 1995;109:237-241.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Sanger F, Nicklen S, Coulson AP. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A 1977;74:5463-5467.
[Abstract/Free Full Text]
-
Vandenplas S, Wiid I, Grobler-Rabie A, Brebner K, Ricketts M, Wallis G, et al. Blot hybridization of genomic DNA. J Med Genet 1984;21:164-172.
[Abstract/Free Full Text]
-
Elo J, Kvist L, Leinonen K, Isomaa V, Henttu P, Lukkarinen O, et al. Mutated human androgen receptor gene detected in a prostatic cancer patient is also activated by estradiol. J Clin Endocrinol Metab 1995;80:3494-3500.
[Abstract]
-
Summers MD, Smith GE. A manual of methods for baculovirus vectors and insect cell culture procedures. Tex Agric Exp Stn Bull 1987;1555:26-28.
-
Vihko P, Kurkela R, Porvari K, Herrala A, Lindfors A, Lindqvist Y, et al. Rat acid phosphatase: overexpression of active, secreted enzyme by recombinant baculovirus infected insect cells. Proc Natl Acad Sci U S A 1993;90:799-803.
[Abstract/Free Full Text]
-
Jovin TM. Multiphasic zone electrophoresis. I. Steady-state moving boundary systems formed by different electrolyte combinations. Biochemistry 1973;12:871-890.
[Medline]
[Order article via Infotrieve]
-
Wyckoff M, Rodbard D, Crambach A. Polyacrylamide gel electrophoresis in sodium dodecyl sulphate containing buffers using multiphasic buffer systems: properties of the stack, valid Rf measurements and optimized procedure. Anal Biochem 1977;78:459-482.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Davis BJ. Disc electrophoresis II: methods and application to human serum proteins. Ann N Y Acad Sci 1964;121:404-427.
-
Andrews AT. Molecular weight measurement and the use of
gel concentration gradients. In: Electrophoresis. Theory, techniques
and biochemical and clinical applications. Oxford, UK: Clarendon Press,
1981:6380..
-
Heukeshoven J, Dernick R. Simplified method for silver staining of proteins in polyacrylamide gels and the mechanism of silver staining. Electrophoresis 1985;6:103-112.
[Web of Science]
-
Prieur B, Russo-Marie F. An automated Western blot analysis using the Phast-System. Anal Biochem 1988;172:338-343.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Akiyama K, Nakamura T, Iwanaga S, Hara M. The chymotrypsin-like activity of human prostate-specific antigen,
-seminoprotein. FEBS Lett 1987;225:168-172.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Kurkela R, Herrala A, Henttu P, Nal H, Vihko P. Expression of active, secreted human prostate-specific antigen by recombinant baculovirus-infected insect cells on a pilot-scale. Bio/Technology 1995;13:1230-1234.
[Medline]
[Order article via Infotrieve]
-
Huber PR, Schmid H-P, Mattarelli G, Strittmatter B, van Steenbrugge GJ, Maurer A. Serum free prostate specific antigen: isoenzymes in benign hyperplasia and cancer of the prostate. Prostate 1995;27:212-219.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Christensson A, Laurell CB, Lilja H. Enzymatic activity of prostate-specific antigen and its reactions with extracellular serine proteinase inhibitors. Eur J Biochem 1990;194:755-763.
[Web of Science][Medline]
[Order article via Infotrieve]
-
Zhang W-M, Leinonen J, Kalkkinen N, Dowell B, Stenman U-H. Purification and characterization of different molecular forms of prostate-specific antigen in human seminal fluid. Clin Chem 1995;41:1567-1573.
[Abstract/Free Full Text]
-
Fichtner J, Graves HCB, Thatcher K, Yemoto C, Shortliffe LMD. Prostate specific antigen releases a kinin-like substance on proteolysis of seminal vesicle fluid that stimulates smooth muscle contraction. J Urol 1996;155:738-742.
[Web of Science][Medline]
[Order article via Infotrieve]
The following articles in journals at HighWire Press have cited this article:

|
 |

|
 |
 
R. K. Nam, W. W. Zhang, L. H. Klotz, J. Trachtenberg, M. A.S. Jewett, J. Sweet, A. Toi, S. Teahan, V. Venkateswaran, L. Sugar, et al.
Variants of the hK2 Protein Gene (KLK2) Are Associated with Serum hK2 Levels and Predict the Presence of Prostate Cancer at Biopsy.
Clin. Cancer Res.,
November 1, 2006;
12(21):
6452 - 6458.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. A. Borgono, I. P. Michael, and E. P. Diamandis
Human Tissue Kallikreins: Physiologic Roles and Applications in Cancer
Mol. Cancer Res.,
May 1, 2004;
2(5):
257 - 280.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. K. Nam, W. W. Zhang, J. Trachtenberg, E. Diamandis, A. Toi, M. Emami, M. Ho, J. Sweet, A. Evans, M. A.S. Jewett, et al.
Single Nucleotide Polymorphism of the Human Kallikrein-2 Gene Highly Correlates With Serum Human Kallikrein-2 Levels and in Combination Enhances Prostate Cancer Detection
J. Clin. Oncol.,
June 15, 2003;
21(12):
2312 - 2319.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. M. Yousef and E. P. Diamandis
The New Human Tissue Kallikrein Gene Family: Structure, Function, and Association to Disease
Endocr. Rev.,
April 1, 2001;
22(2):
184 - 204.
[Abstract]
[Full Text]
|
 |
|