Clinical Chemistry AACC Online Job Center
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 43: 443-452, 1997;
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an electronic Letter to
the Editor about this paper
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (48)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Corey, E.
Right arrow Articles by Vessella, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Corey, E.
Right arrow Articles by Vessella, R. L.
Related Collections
Right arrow Molecular Diagnostics and Genetics
Right arrow Automation and Analytical Techniques
(Clinical Chemistry. 1997;43:443-452.)
© 1997 American Association for Clinical Chemistry, Inc.


Articles

Improved reverse transcriptase–polymerase chain reaction protocol with exogenous internal competitive control for prostate-specific antigen mRNA in blood and bone marrow

Eva Coreya, Edward W. Arfman, Alvin Y. Liu and Robert L. Vessella

a Address correspondence to this author, at: Department of Urology, Mail Stop 356510, University of Washington, Seattle, WA 98195. Fax 206-543-1146; e-mail ecorey{at}u.washington.edu


   Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
The possibility of improving diagnosis of micrometastases from prostate cancer by further enhancing the detection of prostate-specific antigen-producing cells in circulation is being evaluated. We have developed a reverse transcriptase-PCR protocol with the desirable characteristics of low limit of detection, high specificity, reproducibility of response, and ease of performance. Among the procedural alterations that have contributed to these improvements are longer PCR primers, a two-step amplification cycle, and hot-start PCR. We have lowered the limit of detection to one LNCaP prostate-cancer cell in 108 peripheral blood mononuclear cells, and samples of blood and bone marrow from healthy donors have yielded no false positives. Because PCR procedures frequently exhibit tube-to-tube variability, we have incorporated a set of internal and external controls into the protocol—a significant advance in assuring assay reliability.


Key Words: indexing terms: cancer • metastasis • peripheral blood mononuclear cells


   Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Prostate cancer is an increasingly prevalent health problem among men worldwide. Although a complete cure can frequently be achieved through radical prostatectomy, ~20–30% of the patients undergoing this procedure will relapse, even though their tumors had appeared to be clinically localized. Disease recurrence in this subset of patients may arise from the presence of prostate-cancer cells outside the prostate that were undetected at the time of surgery. Accurate staging of the disease when gross metastases are not evident is problematic because the techniques currently in use have poor detection limits for micrometastases. There is therefore an urgent need for improved methods of detecting disseminated prostate cancer.

Gene-amplification techniques, with their high sensitivity, can be used to address this need. Since 1987, reverse transcriptase–polymerase chain reaction (RT-PCR) methodology has been used to detect circulating cells shed by solid tumors, utilizing, e.g., tyrosinase for melanoma (1); tyrosine hydroxylase for neuroblastoma (2); {alpha}-fetoprotein for hepatoma (3); and cytokeratin for breast cancer (4).1 This broad spectrum demonstrates the diagnostic potential of the RT-PCR method. The premise of this approach is that the cells to be detected express mRNA that is not found in other cells within the environment being tested. For detecting prostate cells in circulation, the target transcripts of choice are currently prostate-specific antigen (PSA) and prostate-specific membrane antigen (5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15). Despite the promise of this method, however, it is not yet clear whether RT-PCR will prove to be of clinical value in staging prostate cancer. Results to date are mixed (6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17)(18)(19)(20)(21)(22)(23)(24)(25)(26)(27). The efficiency of circulating tumor cells in causing metastasis is also controversial (28)(29)(30)(31)(32)(33). Better methods and protocols, along with more-comprehensive studies with longer follow-up, are needed to answer these questions.

Here we report an enhanced RT-PCR protocol for detecting prostate cells in circulation by targeting PSA sequences. We have designed and evaluated endogenous and exogenous internal and external controls to ensure uniform performance of the tests. The detection limit of the protocol is ~1 PSA-positive LNCaP cell per 108 peripheral blood mononuclear cells (PBMC), or 5 copies of PSA cDNA, with no signal from negative-control samples.


   Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
samples
Cell culture.
The human prostate cancer cell line LNCaP was obtained from the American Type Culture Collection (Rockville, MD). Cells were grown in RPMI 1640 plus 100 mL/L fetal bovine serum.

Collection of blood samples and isolation of mononuclear cells.
Samples of venous blood (8 mL) were drawn into Vacutainer Tube CPT cell-preparation tubes (Becton Dickinson, Franklin Lakes, NJ) and processed within 2 h. After the samples were centrifuged at 1500–1800g for 30 min at room temperature, the resulting PBMC layers were gently resuspended in plasma and transferred to 50-mL tubes. The volume was brought to 40 mL with Dulbecco's phosphate-buffered saline, and 10-µL aliquots were removed and diluted with 40 µL of 30 mL/L acetic acid for cell counts. The remaining cells were centrifuged at 300g for 20 min at 4 °C and the cell pellets were resuspended in STAT-60 (Tel-Test "B", Friendswood, TX) for RNA isolation.

Collection of bone marrow samples and isolation of mononuclear cells.
Bone marrow samples (10 mL) were drawn into 20-mL syringes containing 10 mL of 60 g/L sodium citrate solution (Pharmaceutical Services, University of Washington, Seattle, WA). The mixtures were transferred to 50-mL tubes, underlaid with 15 mL of Histopaque-1077 (Sigma, St. Louis, MO), and centrifuged at 400gfor 30 min at room temperature. The resulting opaque layers containing the mononuclear cells were then transferred to new tubes and brought to 40 mL volume with phosphate-buffered saline. The cells were isolated for counting as described for blood samples. We processed all of the isolated PBMC for RNA extraction to maximize the chance of detecting prostate cells.

procedures
RNA isolation.
Total RNA was isolated from PBMC by using STAT-60 Total RNA Isolation Reagent (Tel-Test "B") according to the manufacturer's recommendations, except that we used 1 mL of STAT-60 per 5 x 106 PBMC, rather than 1 mL per 10 x 106 PBMC. The isolated RNA was dissolved in 15 µL of "Molecular-Biology-grade" water (5prime-3prime, Boulder, CO) in siliconized, RNase- and DNase-free microcentrifuge tubes. The RNA concentration was determined by measuring absorbance at 260 nm. A 5-µg aliquot of RNA was used for reverse transcription (RT) and the remainder was stored under ethanol at -80 °C.

Reverse transcription.
RT was performed in a volume of 20 µL, as follows: 5 µg of total RNA and 1 µL (0.05 µg) of Random Hexamers (Perkin-Elmer, Branchburg, NJ) were brought up to 10 µL with Molecular-Biology-grade water, heated to 70 °C for 10 min, and then cooled immediately on ice. A master mixture was prepared, 10 µL for each sample, as follows: 4 µL of 5x First Strand Buffer (i.e., 250 mmol/L Tris-HCl, pH 8.3 at room temperature, 375 mmol/L KCl, and 15 mmol/L MgCl2); 2 µL of 0.1 mol/L dithiothreitol; 1 µL of a mixture of dATP, dGTP, dCTP, and dTTP, each at 2.5 mmol/L; 1 µL of RNase Inhibitor (10 units; Perkin-Elmer); 1 µL of reverse transcriptase (200 units, Superscript II Reverse Transcriptase; Gibco-BRL Life Technologies, Grand Island, MD), and 1 µL of H2O. The master mixture was added to each sample tube (containing RNA and primers) and heated for 5 min at 25 °C, followed by 1 h at 42 °C. The reverse transcriptase was deactivated by heating at 99 °C for 5 min.

ß2-Microglobulin (MIC) PCR.
MIC mRNA (43) was used as an endogenous external control for RT. PCR with MIC primers (28-mers; Integrated DNA Technologies, Coralville, IA) yields a 550-bp fragment spanning three exons at positions 148–401, 1018–1045, and 2290–2560 of the MIC gene (GenBank M17987). The specificity of the MIC primers was verified with the GCG program Version 8.1 UNIX (Genetics Computer Group, Madison, WI). Their structure was as follows:

5' MIC primer CACGTCATCCAGCAGAGAATGGAAA-GTC 3' MIC primer TGACCAAGATGTTGATGTTGGATAAGAG

PCR with these primers was performed in a 50-µL volume, with 1 µL of prepared cDNA and 5 pmol of each primer per reaction. A master mixture prepared for a set of simultaneous PCR reactions consisted of 5 µL of 10x PCR Buffer (200 mmol/L Tris, pH 8.3, plus 500 mmol/L KCl), 2 µL of 50 mmol/L MgCl2 (final concentration 2 mmol/L), and 4 µL of a mixture containing 0.5 mmol/L of each dNTP (final concentration 40 µmol/L) per sample. To ensure specificity of the MIC PCR, we used hot-start conditions: For each sample we mixed 0.5 µL of Taq DNA Polymerase (2.5 units; Gibco-BRL) with 0.5 µL of TAQSTART antibody (Clontech Labs., Palo Alto, CA) and incubated this for 5 min at room temperature before adding it to the master mixture. Cycling conditions (Omnigene Thermal Cycler, Hybaid, Middlesex, UK) were: 80 °C for 3 min, 1 cycle; 94 °C for 5 s and 69 °C for 1 min, 25 cycles; and 72 °C for 7 min, 1 cycle. Reaction products were analyzed by electrophoresis in 1.5% agarose gels with 50 mmol/L Tris-borate buffer containing 1 mmol/L EDTA, and were stained with ethidium bromide.

PSA PCR.
The PSA oligonucleotides (Integrated DNA Technologies) were chosen from regions exhibiting high sequence divergence between PSA cDNA and the closely related human glandular kallikrein cDNA (hK2; GenBank M18157), which also is expressed by prostate tissue.

5' PSA primer TTGTGGCCTCTCGTGGCAGGGCAGT

3' PSA primer TGGTCACCTTCTGAGGGTGAACTTGC

PSA cDNA and hK2 cDNA differ at 10 positions within the sequence of the 5' primer and 9 positions within the 3' primer. Because the primer sequences are from different exons of PSA mRNA (5' PSA, exon 2; 3' PSA, exon 4), the researcher can easily determine the presence of genomic DNA contaminants, which would yield much larger products. The 460-bp PCR fragment obtained with these primers has the same sequence as positions 110–569 of PSA cDNA (GenBank M21895).

Specificity of the primers was verified with the GCG UNIX program (see above). PCR was performed in 50-µL volumes as described for MIC PCR, except that 5 µL of prepared cDNA and 5 pmol of each primer were used and the cycling conditions were 80 °C for 3 min, 1 cycle; 94 °C for 5 s; 69 °C for 1 min, 40 cycles; 72 °C per 7 min, 1 cycle.

Restriction enzyme digestion.
To 13 µL of the PSA PCR samples were added 1.5 µL of 10x ClaI enzyme reaction buffer (500 mmol/L Tris-HCl, pH 8, and 100 mmol/L MgCl2) and 0.5 µL of ClaI enzyme (both from Gibco- BRL). The reaction mixture was incubated for 1 h at 37 °C, and the products were analyzed by agarose gel electrophoresis.

Cloning and sequencing
PCR products. PSA PCR products were cloned directly with use of a TA Cloning Kit (Invitrogen, San Diego, CA). Plasmids were transformed into electro-competent Escherichia coli JM109, purified with a Wizard Plasmid Preparation Kit (Promega, Madison, WI), screened by restriction analysis, and sequenced.

determination of detection limit
The detection limit of our protocol was tested in three ways. First, we determined the detection limit of the PCR step by performing PCR with serial dilutions of PSA cDNA cloned into pGEM-3Z (gift of ke Lundwall, Malmo, Sweden), 0 to 160 copies per reaction. Second, we added LNCaP cells total RNA or LNCaP cells to total PBMC RNA or PBMC, respectively, at a ratio of 1 LNCaP cell (or RNA equivalent) per 104, 105, 106, 107, or 108 PBMC (or RNA equivalent) and assayed by RT-PCR to determine how few cells could be detected. Third, to test the detection limit of the entire procedure, we added 2–20 LNCaP cells to 8 mL of PSA-negative blood from female donors. Confluent LNCaP cells were harvested, washed, and counted with a hematocytometer; we then diluted 106 cells resuspended in 1 mL of RPMI 1640 in 10-fold serial dilutions. For the 105/mL dilutions of LNCaP cells, the cells were counted by standard procedures with a hematocytometer; for lower dilutions (104, 103, and 102/mL), we counted the cells in 10 or 20 µL of the cell suspension pipetted onto a microscope slide with a grid. We then pipetted 20–200-µL aliquots of the 102/mL LNCaP cell preparation (containing 2, 5, or 20 cells) into PSA-negative blood samples and processed the cells as described above. The expected frequency of occurrence of various numbers of cells at extreme dilutions was calculated according to the binomial distribution since the number of cells observed is very small relative to the number of cells in the pool (1 x 107 to 2 x 107).

exogenous internal competitive dna control (ic-psa)
Construction.
PSA cDNA excised by EcoRI from pGEM-3Z was recloned into the unique EcoRI site of the plasmid pLOT731 (unlike pGEM-3Z, pLOT731 contains no SacI site). The resulting plasmid was linearized at position 420 of the PSA cDNA by SacI digestion. After treatment with phosphatase (Boehringer Mannheim, Indianapolis, IN), an unrelated PCR fragment 258 bp long was inserted into the SacI site. The insert was prepared by PCR amplification of FAU cDNA positions 164–416 (GenBank X65923) with primers containing SacI restriction sites. This PCR-amplified fragment was digested with SacI, gel-purified, and ligated into the SacI-digested pLOT731 PSA clone. The plasmid was transformed into E. coli JM109. Bacterial colonies containing the desired extended PSA sequences were identified by PCR. Desired colonies yielded a PCR band of 720 bp, representing IC-PSA. This IC-PSA cDNA was excised with EcoRI and cloned back into pGEM-3Z for in vitro transcription.

PCR performance evaluation.
Plasmids (pGEM-3Z) containing either PSA cDNA or IC-PSA cDNA were serially diluted and combined for use in PCR. We used equal amounts of each cDNA in the range 0.00001–1 pg (5- 500 000 copies) of each plasmid DNA. In addition, we used three different amounts of IC-PSA plasmid DNA (0.0001, 0.001, and 0.01 pg, equivalent to 50, 500, and 5000 copies, respectively) in combination with 0.00001–1 pg (5–500 000 copies) of PSA cDNA/pGEM-3Z.

In vitro RNA synthesis.
IC-PSA cDNA in pGEM-3Z was used for RNA synthesis. The IC-PSA cDNA orientation in pGEM-3Z was determined by digestion with BamHI and SacI. An SP6 Megacript Kit (Ambion, Austin, CA) was used according to the manufacturer's recommendations to synthesize the exogenous internal competitive IC-PSA RNA. The plasmid was linearized at position 635 of the PSA sequence with ApaI; the resulting transcript was ~780 bp long. The RNA was used in RT-PCR to verify its identity. Identical reactions, but with reverse transcriptase omitted, were used to monitor contamination by plasmid-derived IC-PSA cDNA.

RT-PCR performance evaluation.
Various concentrations of IC-PSA RNA were added to 5 µg of PSA-negative PBMC RNA that had been adulterated with 5 x 10-7 µg of RNA from LNCaP cells. These mixtures were then subjected to RT-PCR as described above.


   Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
rt-pcr performance evaluated with dilutions of lncap cells
To monitor the specificity of the RT-PCR protocol for the PSA message, we used PSA-positive LNCaP cells. Confluent cells were harvested, and the RNA was extracted. RT was performed with 0.2 µg of RNA from LNCaP cells, and PCRs for MIC and PSA were analyzed, yielding the expected 550-bp product from the MIC message and the 460-bp product from the PSA message. ClaI digestion of the PSA PCR product yielded two fragments, 220 and 240 bp (the hK2 gene does not have this restriction site, so the amplification product from hK2 would be unaffected by ClaI digestion). The PCR fragment from LNCaP cells was cloned and its identity confirmed by DNA sequencing.

To determine the detection limit of the optimized PCR protocol, we performed PCR on serial dilutions of pGEM-3Z with PSA cDNA, yielding 0–160 copies of plasmid per reaction. Results are shown in Fig. 1 . Specificity of the primers for PSA was checked by PCR with an hK2-containing plasmid (gift of D. Tindall, Rochester, NY); no band was observed, even with high concentrations of hK2 cDNA (data not shown).



View larger version (85K):
[in this window]
[in a new window]
 
Figure 1. Detection limit of PCR, shown by agarose gel electrophoresis of PCR products of various dilutions of PSA cDNA-containing pGEM-3Z.

Lane 1, 100-bp DNA ladder; lanes 2–9, various numbers of copies of plasmid containing PSA cDNA (160, 80, 40, 20, 10, 7, 5, and 3 copies, respectively); lane 10, water control.

For evaluating and optimizing the RT portion of the procedure, we performed RT with serial dilutions of LNCaP RNA added to PBMC RNA to yield ratios of 1 prostate cancer cell to 104, 105, 106, 107, or 108 PBMC. We tested the use of 1, 2, or 5 µg of RNA per reaction and 2, 3, and 5 µL of RT product per PCR. The conditions exhibiting the lowest limit of detection and best reproducibility for detection of the PSA message were 5 µg of RNA per RT reaction and 5 µL of RT product per PCR. PCR with MIC primers (the endogenous external control) was used as a positive control for assessing RT performance and the presence of amplifiable messages. Using these conditions, we could detect 1 LNCaP cell per 108 PBMC, as shown in Fig. 2 . We obtained a positive signal from 1 LNCaP cell in a background of 108 PBMC in five out of five experiments performed with various LNCaP- and PBMC-RNA preparations over ~6 months.



View larger version (51K):
[in this window]
[in a new window]
 
Figure 2. Detection limit of RT-PCR, shown by agarose gel electrophoresis of PSA (left 5 lanes) and MIC (right 5 lanes) amplification products after RT-PCR of PBMC RNA supplemented with LNCaP RNA.

From left: lanes 1 and 7, PBMC only; lanes 2 and 8, 1 LNCaP:105 PBMC; lanes 3 and 9, 1 LNCaP:106 PBMC; lanes 4 and 10, 1 LNCaP:107 PBMC; lanes 5 and 11, 1 LNCaP:108 PBMC; lane 6, 100-bp DNA ladder.

We optimized the conditions for RNA extraction by adding dilutions of LNCaP cells directly into PBMC in the same ratios as above and extracting these mixtures. We found that following the manufacturer's recommendation to use 1 mL of STAT-60 per 10 x 106 cells resulted in persistent DNA contamination, whereas using 1 mL of STAT-60 per 5 x 106 cells alleviated the problem. RT-PCR was performed as described above. The detection limit of this cell-addition procedure was also 1 LNCaP cell per 108 PBMC (data not shown).

The limit of detection for the whole method depends on sample collection, blood handling, isolation of cells, and RNA extraction, as well as the RT-PCR procedure itself. For example, in our experience, blood collection into CPT tubes is superior to Ficoll methods for isolation of PBMC and circulating prostate cells. Final testing of the whole procedure was performed with 8-mL samples of blood supplemented directly with dilutions of LNCaP cells in RPMI 1640; the desired numbers of cells were added in volumes of at least 20 µL to CPT tubes containing blood. The average number of cells observed in 10 µL of a theoretical dilution of 104 cells per 1 mL was 98.75 ± 10.62. We repeated these experiments over ~1 year with different preparations of LNCaP cells to establish our limit of detection, i.e., 2 LNCaP cells in 8 mL of peripheral blood (Fig. 3 ). At this high dilution, the tube-to-tube variation in cell content is large relative to the mean; therefore, we used the binomial distribution, which showed that ~59.4% of the tubes would be expected to have at least 2 cells, while 13.5% would be expected to have none. To ascertain whether the actual cell delivery matched theory, we performed cell counts with cell dilutions representing 105, 104, 103, and 102 LNCaP cells per milliliter. At a nominal dilution of 2 cells per 20 µL (100/mL), the counts followed a gaussian distribution and yielded an average of 1.51 ± 0.99 cells per aliquot (n = 37). In particular, whereas the theoretical expectation was that 59.4% of the samples would contain 2 or more cells, the experimental value was 51.4%. A review of 12 RT-PCR experiments performed with the goal of adding 2 LNCaP cells to 8 mL of blood showed that 7 (58.3%) of the experiments yielded the PSA PCR product—in close agreement with the theoretical expectation that 59.4% of the supplemented blood samples would contain 2 or more cells.



View larger version (55K):
[in this window]
[in a new window]
 
Figure 3. Detection limit of overall procedure for determining PSA positivity in blood samples, shown by agarose gel electrophoresis of PSA (left 4 lanes) and MIC (right 4 lanes) amplification products after RT-PCR of RNA extracted from 8 mL of peripheral blood supplemented directly with LNCaP cells.

From left: lanes 1 and 6, 20 added LNCaP cells per 8 mL; lanes 2 and 7, 5 added LNCaP cells; lanes 3 and 8, 2 added LNCaP cells; lanes 4 and 9, blood only; lane 5, 100-bp DNA ladder.

Samples of peripheral blood (n = 40) and bone marrow (n = 30) from negative donors (females or young males) were used as a negative controls. None of the samples exhibited the 460-bp band for PSA mRNA. Preliminary data obtained from clinical trials by this procedure were presented at the 91st Annual American Urological Association Meeting (22)(23).

evaluation of controls
We constructed the IC-PSA cDNA in pGEM-3Z for use in control procedures to evaluate RT-PCR performance. The IC-PSA plasmid contains a PSA cDNA sequence into which an unrelated 258-bp sequence has been inserted, and the IC-PSA cDNA can be amplified by the same primers as the normal PSA cDNA sequence. We performed four different experiments to test for simultaneous detection of the two cDNAs. First, we amplified equimolar mixtures of PSA cDNA/pGEM-3Z and IC-PSA cDNA/pGEM-3Z in the range 0–500 000 copies (Fig. 4 ). Electrophoresis on 1.5% agarose gels easily discriminated the signals from these two sources. PSA cDNA yielded the 460-bp product, whereas the IC-PSA cDNA yielded a 720-bp product.



View larger version (70K):
[in this window]
[in a new window]
 
Figure 4. Competitive PCR detection of IC-PSA and PSA in equimolar mixtures of the respective plasmids.

Lane 1, 100-bp DNA ladder; lanes 2–7, equal numbers of copies of each plasmid, i.e., pg and copies at: (2) 1 and 500 000, (3) 0.1 and 50 000, (4) 0.01 and 5000, (5) 0.001 and 500, (6) 0.0001 and 50, and (7) 0.00001 and 5, respectively; lane 8, water control.

Second, because the amount of PSA message in clinical samples may vary, we tested the effect of three quantities of IC-PSA cDNA/pGEM-3Z (0.0001, 0.001, and 0.01 pg, or 50, 500, and 5000 copies) on PCR performance with PSA cDNA/pGEM-3Z in the range 0.0001–1 pg, or 5–500 000 copies. Because the two amplifications are competitive, the ratio of quantities within which both signals can be detected is limited. Within a factor of 10 in either direction, both bands were detected; at ratios outside this range, however, the more numerous species dominated and the other species was not observed. For example, Fig. 5 illustrates the use of 0.0001 pg (50 copies) of IC-PSA plasmid with PSA plasmid quantities of 0.00001–1 pg (5–500 000 copies). Under these conditions we could detect both IC-PSA cDNA and PSA cDNA in the lowest range in which the PSA cDNA itself is detected (0.00001 pg or 5 copies of PSA cDNA/pGEM-3Z).



View larger version (59K):
[in this window]
[in a new window]
 
Figure 5. PCR of PSA cDNA/pGEM-3Z titrated in the presence of a constant amount (0.0001 pg; 50 copies) of IC-PSA/pGEM-3Z.

The quantity of PSA cDNA/pGEM-3Z used varied from 1 to 0.00001 pg (lanes 2–11, respectively), i.e., 500 000, 50 000, 15 000, 5000, 1500, 500, 150, 50, 15, and 5 copies. Lane 1 shows the 100-bp DNA ladder.

Figure 6 depicts the use of the IC-PSA control in PCR with clinical samples. Six clinical samples were examined with and without the IC-PSA control. The 720-bp band in the control lanes for samples 2, 3, and 4 indicates a proper performance of PCR, and these samples are clearly identified as true-negative samples. For sample 5, no amplification product was detected in either lane (lanes 5 and 5A), indicating that this sample is not a negative sample but rather a case of PCR failure. Another sample from this patient must be examined.



View larger version (64K):
[in this window]
[in a new window]
 
Figure 6. Analysis of six clinical samples with (the A lane of each pair of lanes) and without (numeral only lanes) inclusion of IC-PSA cDNA.

Samples 2–4 are true-negative samples; sample 5 has to be retested. Marker: 100-bp ladder.

To explore the possibility of using IC-PSA at the RNA level to control for performance of RT, we prepared IC-PSA RNA by in vitro transcription. The RNA species obtained was ~780 nucleotides, yielding a DNA fragment of 720 bp by RT-PCR. A control experiment omitting the reverse transcriptase did not yield the 720-bp band. To check the recovery of IC-PSA RNA, we added various amounts of the RNA into aliquots of PBMC that had been adulterated with LNCaP cells, 1:107. The signal from the IC-PSA RNA was detected when the IC-PSA RNA was present at 0.01–10 pg, whereas both IC-PSA and PSA signals were detected for IC-PSA RNA at 0.01–1 pg (Fig. 7 ). However, because we found that the detection limit of IC-PSA RNA was highly variable, we adopted the approach of using an endogenous, external control (MIC) for RT performance and RNA integrity; this control procedure yields an extremely low rate of false negatives.



View larger version (81K):
[in this window]
[in a new window]
 
Figure 7. RT-PCR of IC-PSA RNA added to PBMC RNA adulterated with LNCaP RNA at the rate of 1 LNCaP cell per 107 PBMC cells.

The quantity of IC-PSA RNA added is given for lanes 1–4. Lane 5 is the adulterated PBMC with 0 IC-PSA RNA, and lane 6 is the 100-bp DNA ladder.

An additional control procedure is used only with PSA cDNA-positive samples. The product is digested by the restriction enzyme ClaI, which digests the product of PSA cDNA amplification to yield bands of 220 and 240 bp. Fig. 8 shows the results of ClaI digestion of the PSA and IC-PSA PCR products, as well as a mixture of the two that had been mixed with undigested PSA cDNA after digestion of the pair of products to demonstrate that the undigested band can be easily distinguished from all of the reaction products.



View larger version (91K):
[in this window]
[in a new window]
 
Figure 8. Digestion of PSA and IC-PSA PCR product with ClaI.

Lane 1, 100-bp DNA ladder; lane 2, PSA; lane 3, ClaI digestion of PSA; lane 4, IC-PSA; lane 5, ClaI digestion of IC-PSA; lane 6, mixture of PSA and IC-PSA; lane 7, Cla I digestion of mixture of PSA and IC-PSA followed by addition of undigested PSA.


   Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Metastases account for the majority of cancer deaths. However, the ability of current staging techniques to detect micrometastases is insufficient to support optimal treatment choices. Investigators hope that detection of prostate cells in circulation, even in very low quantities, may provide a new and highly sensitive staging tool for prostate cancer. In 1974, Liotta et al. demonstrated in an animal model that as few as 4 circulating cells appeared to be sufficient for hematogenous dissemination of tumor cells (33). In 1992, Hamdy et al. reported the presence of cells producing PSA in the circulation of some patients with proven prostate cancer metastases (5). Because PSA is produced almost exclusively by prostate epithelial cells (34)(35)(36)(37)(38), the presence of PSA-positive cells in circulation clearly indicates an abnormal condition, and a strong correlation between the appearance of prostate cells in circulation and the advent of metastasis might be expected. Although one group has reported a correlation between the presence of PSA message-positive cells in peripheral blood and recurrent disease after surgery (8)(15)(19)(26), other groups have reported inconclusive results (9)(10)(11)(12)(13)(14)(16)(17)(18)(20)(21)(22)(23)(24)(25). The implications of the presence of prostate cells in circulation are therefore not entirely clear, and a great deal of work remains to be done. Identification and widespread adoption of the best methods for detecting these circulating cells are needed, so that more systematic studies with long-term follow-up may be undertaken and proper conclusions can be drawn.

Because of its sensitivity and selectivity, RT-PCR offers significant improvements in the detection of circulating prostate epithelial cells. Moreover, the detection limit of RT-PCR is better than that of any other methods in current use, e.g., flow cytometry or immunohistochemistry. There is therefore considerable interest in using RT-PCR to detect prostate cells in peripheral blood and bone marrow samples from patients with prostate cancer (5)(6)(7)(8)(9)(10)(11)(12)(13)(14)(15)(19)(20)(21)(22)(23)(24)(25)(26)(27)(28)(29)(30)(31)(32). The bone marrow is of particular interest because of the tendency of prostate cancer to metastasize to bone. In the case of breast cancer, which resembles prostate cancer in being hormone-responsive, there is a documented relation between the presence of breast cancer cells in bone marrow and metastasis (39)(40)(41)(42). Although RT-PCR alone cannot determine whether the PSA cDNA-positive cells detected have malignant properties, correlations with pathology data (6) suggest a possible link between the presence of such cells in circulation and occult metastatic spread of the prostate cancer. Before 1996, the detection limits published for RT-PCR of PSA mRNA did not surpass 1 LNCaP cell in a background of 106 negative cells, as determined by use of a combination of RT-PCR with Southern transfer (6), signal amplification by digoxigenin (8), biotin–streptavidin systems in post-PCR ELISA (14), or nested RT-PCR (7). Recent abstracts have reported detection of 1 LNCaP cell in 107 PBMC (Marakovskiy A, Halpert G, Stein B, Hixson DC. Improved RT-PCR detection of circulating tumor cells in patients with prostate cancer, Abstract at 87th American Association for Cancer Research Annual Meeting, 1996) and 108 PBMC (16)(17). At the 91th American Urological Association Annual Meeting, O'Hara et al. reported (unpublished data) that they detected PSA signal in control samples—7 of 90 men (7.8%), 4 of 44 women (9.1%), and 9 of 54 (16.7%) patients with biopsy-proven benign prostatic hyperplasia—by using the procedure described elsewhere at that meeting (16)(17). They hypothesized that basal amounts of PSA mRNA expression might be responsible for these false positives. However, the agreement between this "false-positive" RT-PCR rate in biopsy-negative patients (16.7%) and the known false-negative rate of biopsies (15–20%) is highly suggestive. That is, these results may not be false positives but rather indicate cases in which RT-PCR has surpassed biopsy as a means of early diagnosis of prostate cancer. Follow-up studies on the patients giving false-positive results in the RT-PCR assay are desirable.

With clinical utility in mind, we set out to develop an RT-PCR protocol that would be highly sensitive and easy to use. Our protocol has a detection limit of 1 LNCaP cell in 108 negative cells, with no false-positive results. Using oligonucleotides 25 and 26 bases long enables us to use a faster, two-step PCR, and hot-start conditions contribute to the high specificity of amplification.

Use of RT-PCR in the clinical setting requires proper controls to assure the validity of results. There are two ways of classifying RT-PCR controls: endogenous or exogenous, and internal or external; in our protocols, the control procedures to be performed with every run are an endogenous external control and an exogenous internal control. The first control is endogenous because it involves amplification of MIC, a species naturally present in the sample; it is external because the amplification is performed in a different reaction vessel. The second control involves addition of the artificially created—exogenous—IC-PSA cDNA to the reaction tube in which the PSA PCR is taking place; this is therefore an internal control procedure for the reaction. The combination of these two procedures ensures the integrity of both the sample and the amplification procedures and virtually eliminates the effect of tube-to-tube variability on the results of the test. In addition to these controls, a detection-limit control containing ~5 copies of PSA cDNA is also run side-by-side with the target samples, and a reaction without cDNA (water control) is run to monitor reagent contamination. Finally, restriction analysis by Cla I is used to confirm the identity of the product in PSA cDNA-positive samples.

The experiments with IC-PSA DNA showed that one could detect both target and internal control sequences when the concentrations of the two did not differ by more than 10-fold. Outside this range, the more-numerous species dominated the reaction and prevented detection of the other species. We therefore decided that 0.0001 pg (50 copies) of the IC-PSA plasmid was the optimal amount to add to the PCR mixture for use with clinical samples (Fig. 6Up ). This permits control of PSA PCR performance at the lowest limit of detection. Higher concentrations of target PSA cDNA dominate the reaction, preventing efficient amplification of IC-PSA cDNA. However, in the lower limit of detection range, the presence of the 720-bp IC-PSA band verifies the PCR performance and greatly reduces the probability that an apparent negative result is in fact a false negative.

Although IC-PSA was constructed for use as a control for both the DNA and RNA aspects of the reaction, we found that RT with the IC-PSA transcript was not sufficiently reproducible for use as a clinical control, possibly because of degradation of uncapped RNA, or loss through interaction with the container's surface at the low concentrations needed for this reaction. Trouble-shooting this control procedure will require additional effort. We therefore settled on the MIC message as a noncompetitive endogenous control for the RT phase of the reaction. The message transcribed from this housekeeping gene is known to be present at approximately constant amounts in all samples we are likely to encounter (43). This type of external control also provides information about the integrity of the RNA preparation. The choice of a gene for use as the endogenous external control is an important issue: The commonly used housekeeping genes glyceraldehyde-3-phosphate dehydrogenase and ß-actin both have the disadvantage that matching processed pseudogenes are known to exist in the human genome. If primers can anneal to a pseudogene, PCR can potentially amplify genomic DNA contamination in addition to the target cDNA, and the two products would be indistinguishable in size. This is a serious problem, because amplification of the pseudogene present in DNA contamination of the RNA preparation would lead to a false assurance that the RT was successful, when in fact the RT may have failed. One must therefore check for the presence of a pseudogene before settling on a particular housekeeping gene to use as a positive RT control.

To eliminate false-positive results, we further tested each PSA-positive sample by digestion with ClaI. Digestion of the 460-bp PSA product by this enzyme yields bands of 220 and 240 bp. The hK2 product, on the other hand, is not digested by this enzyme. This additional step allows us to distinguish a true PSA-amplification event from artifacts caused by mispriming of messages of similar size—and presents a simple alternative to the use of Southern transfer or DNA sequencing procedures to confirm the identity of the amplification products. In the 1100 samples we have thus far examined with this procedure, <1% have yielded 460-bp products that were not digestible by ClaI. In samples that do not exhibit the 460-bp band, however, we have occasionally seen a band of ~430–450 bp that is not digestible by ClaI. Careful examination of electrophoresis results is therefore necessary. Despite the very low frequency of occurrence of false positives, we have performed ClaI digestion for all samples exhibiting bands of a size similar to that of the expected PSA product. The IC-PSA cDNA does not interfere with the interpretation of the digestion result, and in fact represents a positive control for ClaI performance (Fig. 8Up ).

Improvements in RT-PCR procedures leading to a lower detection limit are of potential clinical significance for at least two reasons. First, whereas a typical blood aliquot provides ~107 cells, a bone-marrow sample can easily provide 108 cells, which improves the desired detection limit by an order of magnitude. Second, the procedures described rely on the cell-line LNCaP as a source of PSA-positive cells; however, prostate-cancer cells express variable amounts of PSA mRNA (44). This is not to say that there is no lower bound to the detection limit desired. Smith et al. have detected PSA message in many cell lines that are not of prostate origin, as well as in PBMC of control subjects (11). Such ultrasensitive methods as the ones they have developed are not suitable for prognostic procedures in prostate cancer because a positive result, although it may in fact indicate the presence of PSA messages outside the prostate, has little or no pathological significance (45). In developing diagnostic assays incorporating RT-PCR, one must strike a balance between specificity and detection limit.

In our view, attempts to quantify the PSA-PCR results would complicate the procedure without adding benefits. True quantification of results would require a very detailed examination of the internal RNA controls; because of the wide variation in amounts of PSA mRNA present in prostate cancer cells, however, it is not clear that any improvements in clinical significance would result. Even if we could quantify precisely the number of PSA mRNA molecules in the sample, we would still not know whether the number obtained indicated few cells, each containing many PSA messages, or many cells that contained few messages.

Given that the degree of correlation between the presence of PSA-positive cells in blood or bone marrow and patient prognosis is not yet known, it is too early to assess the significance of the improved detection limit and specificity obtained with these procedures. Clinical trials with the improved RT-PCR protocol are currently underway, designed to evaluate the usefulness of PSA RT-PCR in peripheral blood samples and bone marrow specimens in staging prostate cancer before radical prostatectomy and as a prognostic indicator after prostatectomy (22)(23). After more-extensive evaluation with clinical samples, we expect to include IC-PSA as an internal control in the next series of clinical trials.


   Acknowledgments
 
We thank Sebastian Melchior and William Ellis for their help in providing PSA-negative blood and bone-marrow specimens, Don Riley for his initial help in setting up the RT-PCR assays, Michael Corey for editorial advice, and Matthew Oswin and Maria Ewing for technical assistance. This work was funded by the Richard M. Lucas Foundation, the CaPCURE Foundation, UROCOR Inc., the Department of Veterans' Affairs, and a George M. O'Brien Center Award from the National Institute of Diabetes, Digestive, and Kidney Diseases (1 P50 DK/CA47656–03).


   Footnotes
 
Tumor Immunology Laboratory, Department of Urology, School of Medicine, University of Washington, Seattle, WA 98195.

1 Nonstandard abbreviations: PSA, prostate-specific antigen; RT, reverse transcription; PBMC, peripheral blood mononuclear cells; LNCaP, prostate-cancer cell line; MIC, ß2-microglobulin; IC-PSA, internal control for PSA.


   References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 

  1. Wang X, Heller R, Van Voorhis N, Cruse CW, Glass F, Fenske N, et al. Detection of submicroscopic lymph node metastases with polymerase chain reaction in patients with malignant melanoma. Ann Surg 1994;220:768-774. [ISI][Medline] [Order article via Infotrieve]
  2. Miyajima Y, Kato K, Numata S, Horibe K. Detection of neuroblastoma cells in bone marrow and peripheral blood at diagnosis by the reverse transcriptase-polymerase chain reaction for tyrosine hydroxylase mRNA. Cancer 1995;75:2757-2761. [ISI][Medline] [Order article via Infotrieve]
  3. Komeda T, Fukuda Y, Sando T, Kita R, Fukura M, Nishida N, et al. Sensitive detection of circulating hepatocellular carcinoma cells in peripheral venous blood. Cancer 1995;75:2214-2219. [ISI][Medline] [Order article via Infotrieve]
  4. Datta YH, Adams PT, Drobyski WR, Ethier SP, Terry VH, Roth MS. Sensitive detection of occult breast cancer by the reverse-transcriptase polymerase chain reaction. J Clin Oncol 1994;12:475-482. [Abstract]
  5. Hamdy FC, Lawry J, Anderson JB, Parsons MA, Rees RC, Williams JL. Circulating prostate-specific antigen positive cells correlates with metastatic prostate cancer. Br J Urol 1992;69:392-396. [ISI][Medline] [Order article via Infotrieve]
  6. Deguchi T, Doi T, Ehara H, Ito S, Takahashi Y, Nishino Y, et al. Detection of micrometastatic prostate cancer cells in lymph nodes by reverse transcriptase-polymerase chain reaction. Cancer Res 1993;53:5350-5354. [Abstract/Free Full Text]
  7. Israeli RS, Miller WH, Jr, Su SL, Powell T, Fair WR, Samadi DS, et al. Sensitive nested reverse transcription polymerase chain reaction detection of circulating prostatic tumor cells: comparison of prostate-specific membrane antigen and prostate-specific antigen-based assays. Cancer Res 1994;54:6306-6310. [Abstract/Free Full Text]
  8. Katz AE, Olsson CA, Raffo AJ, Cama C, Perlman H, Seaman E, et al. Molecular staging of prostate cancer with the use of an enhanced reverse transcriptase-PCR assay. Urology 1994;43:765-775. [ISI][Medline] [Order article via Infotrieve]
  9. Seiden MV, Gaynes L, Kaplan I, Krithivas K, Propert K, Bryant M, et al. Detection of circulating tumor cells in men with localized prostate cancer. J Clin Oncol 1994;12:2634-2639. [Abstract/Free Full Text]
  10. Wood DP, Jr, Banks ER, Humphreys S, McRoberts JW, Rangnekar VM. Identification of bone marrow micrometastases in patients with prostate cancer. Cancer 1994;74:2533-2540. [ISI][Medline] [Order article via Infotrieve]
  11. Smith MR, Biggar S, Hussain M. Prostate-specific antigen messenger RNA is expressed in non-prostate cells—implication for detection of micrometastasis. Cancer Res 1995;55:2640-2644. [Abstract/Free Full Text]
  12. Ghossien RA, Scher HI, Gearld WL, Kelly WK, Amsterdam A, Zhang ZF, Rosai J. Detection of circulating tumor cells in patients with localized and metastatic prostatic carcinoma—clinical implications. J Clin Oncol 1995;13:1195-1200. [Abstract]
  13. Loric S, Dumas F, Eschwege P, Blanchet P, Benoit G, Jardin A, Lacour B. Enhanced detection of hematogenous circulating prostatic cells in patients with prostate adenocarcinoma by using nested reverse transcription polymerase chain reaction assay based on prostate-specific membrane antigen. Clin Chem 1995;41:1698-1704. [Abstract]
  14. Galvan B, Christipoulos TK, Diamandis EP. Detection of prostate-specific antigen mRNA by reverse transcription polymerase chain reaction and time-resolved fluorometry. Clin Chem 1995;41:1705-1709. [Abstract]
  15. Katz AE, De Vries GM, Begg MD, Raffo AJ, Cama C, O'Toole K, et al. Enhanced reverse transcriptase polymerase chain reaction for prostate specific antigen as an indicator of true pathologic stage in patients with prostate cancer. Cancer 1995;75:1642-1648. [ISI][Medline] [Order article via Infotrieve]
  16. O'Hara MS, Veltri RW, Skirpstunas P. Basal PSA mRNA levels detected by quantitative reverse transcriptase polymerase chain reaction (Q-RT-PCR-PSA) in blood from subjects without prostate cancer [Abstract]. J Urol 1996;155(Suppl):430A.
  17. Slawin K, Song W, Gottenger RL, Kattan M, O'Hara MS, Wang D, Veltri RW. Comparison of results obtained using different RT-PCR PSA assay methods on a single set of clinical specimens [Abstract]. J Urol 1996;155(Suppl):425A.
  18. Sokollof M, Tso CL, Franklin J, Nelson S, Dorey F, de Kernion J, et al. Quantitative polymerase chain reaction (PCR) does not improve prostate cancer (PC) staging: a clinical-pathologic-molecular analysis of 121 patients [Abstract]. J Urol 1996;155(Suppl):428A.
  19. De Vries GM, Olsson CA, Benson MC, Connor JP, Buttyan R, Katz AE. Qualitative and quantitative RT-PCR for PSA: molecular staging of prostate cancer [Abstract]. J Urol 1996;155(Suppl):426A.
  20. Ignatoff JM, Oefelein MG, Hertz B, Watkin W, Kaul KL. Prostate specific antigen (PSA) reverse transcriptase-polymerase chain reaction (RT-PCR) assay in preoperative staging of prostate cancer [Abstract]. J Urol 1996;155(Suppl):427A.
  21. Wood DP, Jr, Weinstein M, Humphriess S, Rangnekar VM. Prognostic significance of circulating prostate cells [Abstract]. J Urol 1996;155(Suppl):429A.
  22. Ellis WJ, Vessella RL, Corey E, Arfman EW, Oswin M, Melchior SW, Lange PH. Use of a reverse transcriptase polymerase chain reaction (RT-PCR) to detect prostate cells in the blood [Abstract]. J Urol 1996;155(Suppl):272A.
  23. Melchior SW, Corey E, Ellis WJ, Ross AA, Arfman EW, Oswin M, et al. Early tumor cell dissemination in patients with clinically localized carcinoma of the prostate (CaP) [Abstract]. J Urol 1996;155(Suppl):972A.
  24. Moreno JG, Long JP, O'Hara M, Veltri RW, Alexander A, Shupp-Byrne D, Gomella G. Surgical prostatic instrumentation causes showering of prostate cells into the circulation as determined by RT-PCR of PSA [Abstract]. J Urol 1996;155(Suppl):970A.
  25. Cama CL, Olsson CA, Buttyan R, Wise GJ, De Vries G, Katz AE. Molecular staging of prostate cancer III. Effects of digital rectal examination, cytoscopy, and needle biopsy on the enhanced reverse transcriptase polymerase chain reaction assay [Abstract]. J Urol 1996;155(Suppl):971A.
  26. Olsson CA, De Vries GM, Raffo AJ, Benson MC, O'Toole K, Cao Y, et al. Preoperative reverse transcriptase polymerase chain reaction for prostate specific antigen predicts treatment failure following radical prostatectomy. J Urol 1996;155:1557-1562. [ISI][Medline] [Order article via Infotrieve]
  27. Diamandis EP, Yu H. Prostate cancer, prostate-specific antigen, and the polymerase chain reaction [Editorial]. Clin Chem 1995;41:177-179. [Free Full Text]
  28. Weiss L. Metastatic inefficiency: causes and consequences. Cancer Rev 1986;3:1-24.
  29. Tarin D, Price JE, Kettlewell MGW, Souter RG, Vass ACR, Crossley B. Mechanisms of human tumor metastasis studied in patients with peritovenous shunts. Cancer Res 1984;44:3584-3592. [Abstract/Free Full Text]
  30. Koike A. Mechanism of blood-borne metastases. I. Some factors affecting lodgement and growth of tumor cells in the lungs. Cancer 1964;17:450-460.
  31. Liotta LA, Kleinerman J, Saidel GM. The significance of hematogenous tumor cell clumps in the metastatic process. Cancer Res 1982;45:44-53.
  32. Rinker-Schaeffer CS, Partin AW, Isaacs WB, Coffey DS, Isaacs JT. Molecular and cellular changes associated with the acquisition of metastatic ability by prostatic cancer cells. Prostate 1994;25:249-265. [ISI][Medline] [Order article via Infotrieve]
  33. Liotta LA, Kleinerman J, Saidel GM. Quantitative relationships of intravascular tumor cells, tumor vessels and pulmonary metastases following tumor implantation. Cancer Res 1974;34:997-1003. [Abstract/Free Full Text]
  34. Oesterling JE. Prostate-specific antigen: a critical assessment of the most useful tumor marker for adenocarcinoma of the prostate. J Urol 1991;145:907-923. [ISI][Medline] [Order article via Infotrieve]
  35. Zarghami N, Diamandis EP. Detection of prostate-specific antigen mRNA and protein in breast tumors. Clin Chem 1996;42:361-366. [Abstract/Free Full Text]
  36. Levesque M, Yu H, D'Costa M, Diamandis EP. Prostate-specific antigen expression by various tumors. J Clin Lab Anal 1995;9:123-128. [ISI][Medline] [Order article via Infotrieve]
  37. Levesque M, Yu H, D'Costa M, Tadross L, Diamandis EP. Immunoreactive prostate-specific antigen in lung tumors. J Clin Lab Anal 1995;9:375-379. [ISI][Medline] [Order article via Infotrieve]
  38. Clements J, Mukhtar A. Glandular kallikreins and prostate-specific antigen are expressed in the human endometrium. J Clin Endocrinol Metab 1994;78:1536-1539. [Abstract]
  39. Cote RJ, Rosen PP, Lesser ML, Old LJ, Osborne MP. Prediction of early relapse in patients with operable breast cancer by detection of occult bone marrow micrometastases. J Clin Oncol 1991;9:1749-1756. [Abstract]
  40. Osborne MP, Rosen PP. Detection and management of bone marrow micrometastases in breast cancer. Oncology 1994;8:25-31. [Medline] [Order article via Infotrieve]
  41. Redding WH, Coombes RC, Monaghan P, Clink HM, Imrie SF, Dearnaley DP, et al. Detection of micrometastases in patients with primary breast cancer. Lancet 1983;ii:1271-1274.
  42. Diel IJ, Kaufmann M, Goerner R, Costa SD, Kaul S, Bastert G. Detection of tumor cells in bone marrow of patients with primary breast cancer: a prognostic factor for distant metastasis. J Clin Oncol 1992;10:1534-1539. [Abstract/Free Full Text]
  43. Güssow D, Rein R, Ginjaar I, Hochstenbach F, See G, Kottman A, Ploegh HL. The human ß-2-microglobulin gene: primary structure and definition of the transcriptional unit. J Immunol 1987;139:3132-3138. [Abstract]
  44. Qiu SD, Young CY, Bilhartz DL, Prescott JL, Farrow GM, He WW, Tindall DJ. In situ hybridization of prostate-specific antigen mRNA in human prostate. J Urol 1990;144:1550-1556. [ISI][Medline] [Order article via Infotrieve]
  45. Chelly J, Concordet JP, Kaplan JC, Kahn A. Illegitimate transcription: transcription of any gene in any cell type. Proc Natl Acad Sci U S A 1989;86:2617-2621. [Abstract/Free Full Text]



The following articles in journals at HighWire Press have cited this article:


Home page
Clin. Chem.Home page
D. Schamhart, J. Swinnen, K.-H. Kurth, A. Westerhof, R. Kusters, H. Borchers, and C. Sternberg
Numeric Definition of the Clinical Performance of the Nested Reverse Transcription-PCR for Detection of Hematogenous Epithelial Cells and Correction for Specific mRNA of Non-Target Cell Origin as Evaluated for Prostate Cancer Cells
Clin. Chem., September 1, 2003; 49(9): 1458 - 1466.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pathol.Home page
D Grammatopoulos, Y Elliott, S C Smith, I Brown, R J Grieve, E W Hillhouse, M A Levine, and M D Ringel
Measurement of thyroglobulin mRNA in peripheral blood as an adjunctive test for monitoring thyroid cancer
Mol. Pathol., June 1, 2003; 56(3): 162 - 166.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
A. Ylikoski, K. Pettersson, J. Nurmi, K. Irjala, M. Karp, H. Lilja, T. Lovgren, and M. Nurmi
Simultaneous Quantification of Prostate-specific Antigen and Human Glandular Kallikrein 2 mRNA in Blood Samples from Patients with Prostate Cancer and Benign Disease
Clin. Chem., August 1, 2002; 48(8): 1265 - 1271.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
E. Corey, J. E. Quinn, M. J. Emond, K. R. Buhler, L. G. Brown, and R. L. Vessella
Inhibition of Androgen-independent Growth of Prostate Cancer Xenografts by 17{beta}-Estradiol
Clin. Cancer Res., April 1, 2002; 8(4): 1003 - 1007.
[Abstract] [Full Text] [PDF]


Home page
J. Mol. Diagn.Home page
A. Ylikoski, M. Karp, K. Pettersson, H. Lilja, and T. Lovgren
Simultaneous Quantification of Human Glandular Kallikrein 2 and Prostate-Specific Antigen mRNAs in Peripheral Blood from Prostate Cancer Patients
J. Mol. Diagn., August 1, 2001; 3(3): 111 - 122.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Malatesta, F. Mannello, F. Luchetti, F. Marcheggiani, L. Condemi, S. Papa, and G. Gazzanelli
Prostate-Specific Antigen Synthesis and Secretion by Human Placenta: A Physiological Kallikrein Source during Pregnancy
J. Clin. Endocrinol. Metab., January 1, 2000; 85(1): 317 - 321.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
M. D. Ringel, P. L. Balducci-Silano, J. S. Anderson, C. A. Spencer, J. Silverman, Y. H. Sparling, G. L. Francis, K. D. Burman, L. Wartofsky, P. W. Ladenson, et al.
Quantitative Reverse Transcription-Polymerase Chain Reaction of Circulating Thyroglobulin Messenger Ribonucleic Acid for Monitoring Patients with Thyroid Carcinoma
J. Clin. Endocrinol. Metab., November 1, 1999; 84(11): 4037 - 4042.
[Abstract] [Full Text]


Home page
Clin. Chem.Home page
A. Ylikoski, M. Sjoroos, A. Lundwall, M. Karp, T. Lovgren, H. Lilja, and A. Iitia
Quantitative Reverse Transcription-PCR Assay with an Internal Standard for the Detection of Prostate-specific Antigen mRNA
Clin. Chem., September 1, 1999; 45(9): 1397 - 1407.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. L. Cher, J. G. de Oliveira, A. A. Beaman, J. A. Nemeth, M. Hussain, and D. P. Wood Jr.
Cellular Proliferation and Prevalence of Micrometastatic Cells in the Bone Marrow of Patients with Clinically Localized Prostate Cancer
Clin. Cancer Res., September 1, 1999; 5(9): 2421 - 2425.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
F. Mannello, M. Malatesta, F. Luchetti, S. Papa, S. Battistelli, and G. Gazzanelli
Immunoreactivity, Ultrastructural Localization, and Transcript Expression of Prostate-specific Antigen in Human Neuroblastoma Cell Lines
Clin. Chem., January 1, 1999; 45(1): 78 - 84.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. D. Ringel, P. W. Ladenson, and M. A. Levine
Molecular Diagnosis of Residual and Recurrent Thyroid Cancer by Amplification of Thyroglobulin Messenger Ribonucleic Acid in Peripheral Blood