Clinical Chemistry
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 44: 930-938, 1998;
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (81)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haller, C.
Right arrow Articles by Katus, H. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haller, C.
Right arrow Articles by Katus, H. A.
Related Collections
Right arrow Proteomics and Protein Markers
(Clinical Chemistry. 1998;44:930-938.)
© 1998 American Association for Clinical Chemistry, Inc.


Enzymes and Protein Markers

Cardiac troponin T in patients with end-stage renal disease: absence of expression in truncal skeletal muscle

Christlieb Haller1, Jörg Zehelein1, Andrew Remppis2, Margit Müller-Bardorff2, and Hugo A. Katus2,a

1 Department of Medicine III, University of Heidelberg, 69115 Heidelberg, Germany.

2 Department of Medicine II, University of Lübeck, 23538 Lübeck, Germany.
a Address correspondence to this author at: Department of Internal Medicine II, University of Lübeck, Ratzeburger Allee 160, D-23538 Lübeck Germany. Fax 49-451-5006437.


   Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
In patients with end-stage renal disease (ESRD), the serum concentration of cardiac troponin T (cTnT) may be increased without cardiac ischemia. One reason for this unexplained increase could be the extracardiac expression of cTnT. However, truncal skeletal muscle biopsies of five patients with ESRD showed no evidence of the expression of either cTnT mRNA (reverse transcription-PCR) or protein (immunoblot, immunofluorescence). We also measured the serum concentration of cTnT in 97 patients with ESRD. The serum cTnT concentration determined in both first and second generation cTnT assays was significantly lower P <0.01 in patients with a low cardiac risk than in patients with positive indicators of coronary artery disease. The correlation between cTnT and indicators of coronary artery disease is consistent with the hypothesis that cTnT in the serum of patients with ESRD originates from the heart.


   Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Cardiovascular complications are the most important cause of morbidity and mortality in patients with end- stage renal disease (ESRD)1 (1)(2). The diagnosis and risk stratification of coronary artery disease (CAD) are key issues in the clinical management of these patients (3). Recently the myofibrillar proteins of the troponin complex (4) have been introduced as novel serodiagnostic markers of myocardial cell injury (5)(6). The high concentration in the myocardium and the tissue-specific expression of the cardiac troponins (7)(8)(9)(10)(11) are the basis for the excellent sensitivity and specificity of the respective immunoassays in a variety of clinical settings, including minor cardiac muscle damage (12)(13). In patients with renal failure, the diagnostic utility of the cardiac troponins has been challenged by the observation that both troponin T (14)(15)(16)(17)(18)(19)(20) and troponin I (17)(18)(19)(20) may be increased in the serum of uremic patients without clinical evidence of acute cardiac ischemia. The cause of the increased serum concentration of cardiac troponins in patients with ESRD is not clear. Because this increased serum troponin concentration is particularly prominent for cardiac troponin T (cTnT), it has been suggested that this may reflect an altered regulation of tissue-specific cardiac troponin expression that leads to the expression of cTnT in skeletal muscle. Indeed, such an extracardiac expression of cTnT has been reported in diseased/regenerating skeletal muscle (21)(22)(23). Therefore, it has been speculated that the increased concentration of cTnT in the serum of some dialysis patients without evidence of cardiac ischemia results from the extracardiac expression of cTnT in uremic skeletal muscle (24)(25). Recently McLaurin et al. (26) reported cTnT expression in the skeletal muscle of dialysis patients, but the evidence is not conclusive (27). To investigate the potential expression of cTnT in skeletal muscle, we analyzed the expression of cTnT in skeletal muscle specimens of five hemodialysis patients at the RNA or protein level. We also investigated the incidence of an increased cTnT concentration in the blood of 97 patients on chronic maintenance hemodialysis, using both a first (28) and a second generation cTnT assay (29). The main difference between these two assays is that the first generation test used a combination of a cardiac-specific and a nonspecific antibody, whereas the second assay consists of two cardiac-specific antibodies. Because of the paired cardiac-specific antibodies, the second generation cTnT assay has a higher specificity than its predecessor (29).


   Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
patients
cTnT was measured in the EDTA-treated plasma of 97 patients from two dialysis centers (47 patients in one center and 50 patients in the other) as part of routine monthly laboratory surveys. Clinical patient information was obtained by patient interviews and the review of dialysis charts. None of the patients had acute myocardial infarction, as diagnosed by standard electrocardiographic and/or enzyme criteria. The patients gave informed consent, and the study was approved by the ethics committee of the University of Heidelberg Medical School.

All patients had a 2D-echocardiographic examination within 6 months before the study. For analysis of the data, the patients were stratified into three groups according to their likelihood of having CAD: group A, patients with known CAD (previous myocardial infarction and/or >50% stenosis of at least one major coronary artery at coronary angiography); group B, patients with two or more recognized major risk factors for CAD in addition to ESRD (smoking, hypertension, diabetes, or hypercholesterolemia); or group C, patients with one or no other coronary risk factor except ESRD.

expression of cTnT in skeletal muscle
Five patients with ESRD (all with an increased plasma concentration of cTnT; 0.25–5.32 µg/L, first generation assay) and one control patient with healthy renal function (living related donor for kidney transplantation; plasma cTnT, 0.07 µg/L, first generation assay) underwent elective surgery. Skeletal muscle specimens were obtained from the operation site (abdominal wall or back muscles) under direct vision while the patients were under general anesthesia. The tissue samples were divided in the operating room into two aliquots: One aliquot was snap-frozen in liquid nitrogen; the other aliquot was immediately immersion-fixed in 30 g/L paraformaldehyde and 10 g/L glutaraldehyde in phosphate-buffered saline (140 mmol/L sodium chloride, 4 mmol/L sodium phosphate, 1.5 mmol/L potassium phosphate, and 2.7 mmol/L potassium chloride), pH 7.4. All chemicals were purchased from Sigma Chemical Co. unless indicated otherwise.

reverse transcription–pcr (rt-pcr) of troponin t in skeletal muscle
Total RNA was isolated from the snap-frozen muscle biopsy specimens according to the method of Chirgwin et al. (30). One hundred milligrams of the muscle tissue yielded ~80 µg of RNA. The RNA was reverse transcribed using M-MLV reverse transcriptase (Life Technologies) according to the supplier's protocol. The reverse-transcribed cDNAs were amplified by PCR using the following oligonucleotide primers:

(a) human slow skeletal muscle troponin T amplification (31),

forward: CCTCGAGATTCACAGCATCTC

reverse: AGCTGCAGCAGGTCTTTCTC; or

(b) human cTnT amplification (32),

forward: GGAGAGCAGAGACCATGT

reverse: ACTCTCTCTCCATCGGGGATC.

The amplified DNA fragments were visualized by agarose gel electrophoresis combined with ethidium bromide staining.

immunoblot
Frozen muscle specimens were ultrasonically lysed in 50 mmol/L KCl, 2 mol/L urea, 50 mmol/L Tris-HCl, pH 7.5, and immediately transferred into sodium dodecyl sulfate (SDS) sample buffer (33), boiled for 15 seconds, and subjected to SDS-polyacrylamide gel (15%) electrophoresis. The separated proteins were electrophoretically blotted onto a polyvinylidene difluoride membrane (Millipore), using a semidry transfer apparatus.

The membranes were blocked with 30 g/L casein in incubation buffer (150 mmol/L NaCl, 10 mmol/L Tris-HCl, 10 g/L Tween 20, pH 8) for 1 h at room temperature. The membranes were then incubated for 1 h at room temperature with a mouse monoclonal antibody (1B10) that recognizes both the skeletal and cardiac muscle isoforms of human troponin T (34) at a dilution of 1:10 000. Alkaline phosphatase-conjugated goat anti-mouse IgG (Dianova) was used at a dilution of 1:20 000 for the detection of specific antibody binding with a chemoluminescence kit (Tropix) and an exposure time of 10 min. The cardiac and skeletal muscle isoforms could be discerned by their different molecular masses by means of their distinctive migration pattern on SDS-polyacrylamide gel electrophoresis. For both the RT-PCR and immunoblot experiments, postmortem human myocardium was used as a positive control. The cardiac specimen of a previously healthy, violent crime victim was obtained 6 h postmortem from the Department of Forensic Pathology at the University of Heidelberg.

indirect immunofluorescence
Small pieces of immersion-fixed skeletal muscle were epon-embedded and sectioned with an ultramicrotome. Epon sections (0.5 µm) on microscopy slides were blocked at room temperature with 10 g/L bovine serum albumin and 0.5 g/L saponin in phosphate-buffered saline, pH 7.4, for 20 min. The sections were incubated with cTnT-specific mouse monoclonal antibody 1H10 overnight at 4 °C at a dilution of 1:5000 in blocking buffer. After the sections were washed with phosphate-buffered saline, they were incubated for 1 h at room temperature in Cy3-conjugated anti-mouse IgG (Dianova). Immersion-fixed right ventricular biopsies from cardiac transplant recipients were used as positive controls. The muscle sections were examined with a Zeiss photomicroscope.

cTnT measurement in blood
Plasma samples derived from EDTA-treated blood obtained during routine monthly predialysis blood draws were stored at -20 °C for later batch analysis of the cTnT concentration. cTnT was measured in plasma using a first (35) and a second generation (29) cTnT sandwich ELISA and an ES 300 (Boehringer Mannheim). A discriminator value of 0.2 µg/L was chosen in the first generation assay (35); 0.15 µg/L was the cutoff value in the second generation assay. Total creatine kinase (CK) activity was measured in the clinical chemistry laboratory of the University of Heidelberg Medical School, using a standard colorimetric assay (Beckmann).

statistical analysis
All measurements are presented as median and quartiles denoting the 25th and the 75th percentile of the distribution. The overall differences between the cTnT concentrations in the three patient groups (global hypothesis) were tested with the nonparametric Kruskal–Wallis test. Because there was a significant difference (P <0.01) between the groups, pairwise comparisons were carried out with the nonparametric Wilcoxon signed rank test.

The prevalence of increased cTnT values (>=0.2 µg/L, first generation assay; >=0.15 µg/L, second generation assay) in the different patient groups was compared using contingency table analysis. Contingency table analysis over the three groups rejected the global hypothesis that there was no difference between the groups. Therefore, pairwise comparisons of the groups were carried out using contingency table analysis with continuity correction.


   Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
RT-PCR analysis using oligonucleotide primers specific for the cardiac and skeletal muscle isoform of troponin T showed the respective isoform-specific amplification products of reverse-transcribed and PCR-amplified RNA in both cardiac and skeletal muscle tissue. However, the cardiac isoform was expressed only in the (positive) control myocardial tissue, not in skeletal muscle whether it was uremic or control skeletal muscle (Fig. 1 ). The detection of cTnT in the cardiac tissue and the skeletal muscle of hemodialysis patients by immunoblot is shown in Fig. 2 . The anti-troponin T antibody 1B10 recognizes both cardiac and skeletal muscle isoforms of troponin T (34), which can be distinguished clearly by their different migration patterns on SDS-polyacrylamide gel electrophoresis. cTnT was absent in the truncal skeletal muscle of five dialysis patients with increased plasma cTnT concentrations, as well as in a patient with healthy renal function.



View larger version (60K):
[in this window]
[in a new window]
 
Figure 1. PCR amplification of troponin cDNA sequences from reverse-transcribed muscle RNA.

Left of 100-bp DNA ladder: amplification of skeletal muscle-specific human troponin T sequence. Right of 100-bp DNA ladder: amplification of cardiac-specific human troponin T sequence. (Lane 1) Human left ventricle (cardiac muscle control), (lane 2) human psoas muscle (skeletal muscle control), (lanes 3–6) truncal skeletal muscle biopsies from patients with ESRD on chronic maintenance hemodialysis. PCR amplification was successful with both the cardiac and skeletal muscle-specific primer pairs. The primers for cTnT produced a specific amplification product in human cardiac tissue (lane 1) but not in any of the skeletal muscle samples. Thus, there was no evidence of transcription of the cardiac isoform of troponin T in any of the truncal skeletal muscle specimens from uremic patients.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 2. Immunological detection of troponin T polypeptides.

(A) 15% polyacrylamide gel stained with Coomassie blue showing the relative excess loading of skeletal muscle proteins from the biopsies (lanes 1–6) compared with control cardiac muscle protein (lane C). (B) Immunoblot of cardiac and skeletal muscle using the TnT-specific but not cardioselective monoclonal antibody 1B10. The control lane (C) shows the distinctive 36-kDa band and a typical degradation product (~30 kDa) of the human cardiac isoform of troponin T, whereas the skeletal muscle lanes (1)(2)(3)(4)(5)(6) display only the lower molecular weight troponin T isoforms typical of human skeletal muscle. cTnT was not expressed in any of the truncal skeletal muscle biopsies.

The results of a representative immunofluorescence experiment on a truncal skeletal muscle specimen from a hemodialysis patient with a serum troponin T concentration of 0.41 µg/L (first generation assay) is shown in Fig. 3 . The mouse monoclonal antibody specific for the cardiac isoform of human troponin T (1H10) failed to stain the skeletal muscle sections of the uremic patient (data not shown), whereas there was specific sarcomeric staining for cTnT in human cardiac control tissue. The cardiac-specific antibody also failed to bind to the truncal skeletal muscle of four other patients with ESRD who had serum cTnT concentrations of 0.37, 5.32, 0.25, and 0.5 µg/L (first generation assay).



View larger version (112K):
[in this window]
[in a new window]
 
Figure 3. Immunofluorescence of cTnT in a cardiac muscle biopsy.

The anti-cTnT antibody 1H10 produced a bright, striated signal in a cardiac muscle specimen; however, a truncal skeletal muscle biopsy from a patient with ESRD incubated in parallel with the cardiac muscle biopsy showed no evidence of cardiac troponin immunoreactivity. Scale bar (white bar) represents 1 µm.

The measurements of cTnT in the blood of 97 patients on chronic maintenance hemodialysis showed that cTnT is detectable in a substantial subgroup of these patients. Table 1 shows the demographic characteristics of the hemodialysis patients from the two dialysis centers. Patient age and comorbidity were similar in the two centers. The patients were stratified into three groups according to cardiac risk (Table 2 ). There were no major differences between the three patient groups with regards to renal diagnosis, duration of hemodialysis, or dialysis protocols/efficiency. However, because of the stratification criteria, the prevalence of cardiac risk factors was lower in group C. Because the patients in group C were younger and generally less sick, it can be inferred that the medications were different between the groups. No history of uremic myopathy was available, but there was no difference in the serum parathyroid hormone concentrations that are generally regarded as a marker for uremic musculoskeletal disease. The prevalence of cardiac risk factors was similar in groups A and B, and most patients in these two groups had echocardiographic evidence of concentric left ventricular hypertrophy.


View this table:
[in this window]
[in a new window]
 
Table 1. Demographic characteristics of patients from the two dialysis centers.


View this table:
[in this window]
[in a new window]
 
Table 2. Stratification of patients from both dialysis centers according to risk of cardiac ischemia.

When the serum samples were analyzed with the first generation cTnT ELISA, 39% of the patients had a serum concentration of cTnT >=0.2 µg/L, which is the upper limit of the reference interval determined in patients with intact renal function. At the chosen cutoff value of the second generation cTnT ELISA (cTnT >=0.15 µg/L), 29% of the dialysis patients had an increased serum concentration, but only 24% exceeded 0.2 µg/L. The increase in serum concentration of cTnT did not correlate with the patients' age or sex, the duration of hemodialysis, the cause of renal failure, residual urine production, or indicators of dialysis efficiency, such as pre- and postdialysis blood urea nitrogen concentrations, ß2-microglobulin concentrations, parathyroid hormone concentrations, or nutritional status (data not shown).

As can be seen in Table 3 ), in both the first and the second generation cTnT assays, the prevalence of increased cTnT concentrations correlated with cardiac risk, as indicated by the significant difference between groups A and C (P = 0.0196 in the first generation assay and P = 0.0074 in the second generation assay). There was a trend towards a difference between groups B and C, which reached borderline significance (P = 0.0510) in the first generation cTnT assay.


View this table:
[in this window]
[in a new window]
 
Table 3. Prevalence of pathological cTnT plasma concentrations1 in ESRD patients on chronic maintenance hemodialysis.

Table 4 shows the median cTnT concentration in the three groups. In both assays, the patients in group A with established CAD had a significantly higher median plasma concentration of cTnT compared with patients in the low risk group C. The median cTnT concentration in group B was similar to that of group A, but significantly different from group C.


View this table:
[in this window]
[in a new window]
 
Table 4. Median plasma concentrations of cTnT in patients on chronic maintenance hemodialysis.


   Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
The results of the present study show an increased steady-state plasma cTnT concentration (>=0.2 µg/L) in 39% (first generation cTnT ELISA) of a large and representative population of hemodialysis patients. When the second generation cTnT ELISA was used, 29% of the hemodialysis patients had increased cTnT concentrations, even when a cutoff value (>=0.15 µg/L) higher than the discriminator value recommended for patients without renal failure (>=0.1 µg/L) (29) was used. The higher discriminator value was chosen to increase the specificity of the measurement with the second generation cTnT ELISA.

Although the reasons for the increased cTnT concentrations in the blood of dialysis patients without clinical evidence of myocardial cell injury are not clear, the present results are consistent with the hypothesis that the cTnT measured in the blood of dialysis patients may be of cardiac origin. The two main findings of the present study are the absence of cTnT expression in the truncal skeletal muscle of five hemodialysis patients with an increased serum cTnT concentration and the correlation between the plasma cTnT concentration and indicators of CAD.

cTnT assays
cTnT has been systematically evaluated as a serodiagnostic tool for myocardial cell injury in patients without renal disease (12). Specific monoclonal antibodies that do not cross-react with extracardiac TnT isoforms are available and have been extensively characterized (28). The sensitivity and specificity of assays using cTnT as a diagnostic marker has been demonstrated in a variety of clinical settings, such as acute myocardial infarction (35), unstable angina (36), and perioperative myocardial infarction (37), which poses a particular challenge for a test to differentiate between skeletal and cardiac muscle cell injury.

In patients with end-stage renal disease–a population with a high prevalence of ischemic heart disease–the diagnostic performance of cTnT as a serodiagnostic marker for myocardial ischemia has not been systematically evaluated. Several case reports and reports from small patient series have suggested that cTnT concentrations may be increased in the serum of hemodialysis patients without myocardial ischemia (14)(15)(16)(17). In theory, this could be a laboratory artifact of the cTnT assay in the presence of uremic serum. Interferences between uremic serum and the cTnT assay have not been evaluated. However, the theoretical possibility of artifactual interference between blood factors present only in dialysis patients and cTnT measurements is not likely because there was no apparent correlation between dialysis duration, residual urine production, and other standard indicators of dialysis efficiency. Only a subgroup of patients had increased cTnT concentrations, whereas other patients exhibited no increase in serum cTnT concentrations despite a similar uremic/dialytic state. Thus, neither the uremic state itself nor the hemodialysis procedure accounts for the increased cTnT values; rather, some patient-related factor appears to be involved. Both the first and second generation cTnT assays yielded a high prevalence of increased serum cTnT concentrations, even when the discriminator value of the second generation assay was adjusted from the recommended value of 0.1 µg/L in patients without renal disease to 0.15 µg/L in patients with ESRD. This argues against the interpretation that an increased cTnT concentration in dialysis patients merely represents an assay artifact, because the newer assay with a different antibody combination and an increased specificity (29) produced a prevalence of increased cTnT concentrations similar to that of the first generation assay. Thus, it is not unreasonable to speculate that both assays measure cTnT circulating in the blood of a substantial subgroup of hemodialysis patients.

correlation with cardiac risk factors
We hypothesized that the increased cTnT concentration in the serum of some dialysis patients might be related to subclinical myocardial cell injury, which could occur during the hemodynamic "stress" of hemodialysis. cTnT has a serum half-life of 1.5 h in patients without renal failure. Hence, the increased steady-state concentration of cTnT in the serum of some patients with ESRD could be a cumulative result of (repetitive) subclinical myocardial cell injury during hemodialysis.

Our results show a correlation between the cTnT concentration measured with the first generation cTnT assay and indicators of CAD. This is consistent with the hypothesis that the increased cTnT concentration may indeed be of cardiac origin. Hence, the high sensitivity of the cTnT assay may allow the detection of subclinical myocardial cell injury in the setting of hemodialysis.

In addition to CAD, the uremic state itself could predispose the heart to myocardial cell injury. Experimental studies in uremic animals have shown a pronounced, blood pressure-independent microvascular rarefaction and fibrosis in cardiac muscle, which was presumed to be produced by chronic ischemia in the absence of epicardial stenotic lesions (38)(39)(40). It could be speculated that this structural alteration of cardiac muscle during uremia, especially when combined with hypertensive left-ventricular hypertrophy and/or CAD, could be the cause of subclinical, slowly ongoing cardiac cell damage that leads to the release of small amounts of cTnT into the circulation, which may be detected with the sensitive cTnT assays. In this context, it may be relevant that most of the patients in this study had echocardiographic evidence of left-ventricular hypertrophy, because echocardiographic abnormalities were associated with increased cTnT concentrations in a pediatric hemodialysis population (41). Taken together, the available data are consistent with the hypothesis that cTnT in the serum of dialysis patients is of cardiac origin rather than an assay artifact or a result of extracardiac expression. Nevertheless, to exclude the latter possibility, we investigated the expression of cTnT in skeletal muscle biopsies of hemodialysis patients.

absence of extracardiac expression of cTnT
The tightly regulated tissue-specific expression of cTnT (42)(43) is the basis for its diagnostic specificity as a marker for myocardial cell injury. Unlike the conventional cardiac enzymes, cTnT is undetectable with the available assays in the serum under nonischemic conditions in patients without renal failure. Thus, no ambiguity exists in the interpretation of cTnT serum concentrations, because circulating cTnT necessarily derives from injured cardiomyocytes unless there is extracardiac expression of cTnT in skeletal muscle. Because of the large mass of skeletal muscle and the propensity for minor trauma during daily activities, the expression of cTnT in uremic skeletal muscle could evidently explain an increased steady-state serum concentration of cTnT. It has been reported that injured or regenerating skeletal muscle can express different protein isoforms compared with quiescent/fully differentiated muscle. Recent work has demonstrated decreased enzymatic activities in energy-providing metabolic pathways in uremic patients (44). The extracardiac expression of cTnT in injured or diseased skeletal muscle has been reported in animals (23) and in humans with polymyositis/dermatomyositis (22). Recently McLaurin et al. (26) reported evidence of cTnT expression in skeletal muscle of dialysis patients. However, this evidence is not conclusive for a variety of reasons (27). These authors used an anti-cTnT antibody that reportedly cross-reacted with some human skeletal muscle troponin T isoforms. The reduced specificity of the antibody and the low resolution of the immunoblot shown in their article limit the interpretation that cTnT may be expressed in the skeletal muscle of dialysis patients.

In our study, we used a specific antibody against the cardiac isoform of troponin T, which did not react with skeletal muscle tissue but showed a specific band in cardiac control tissue. One limitation of both the present study and the study performed by McLaurin et al. is that proximal extremity muscles, which are the most common target of uremic myopathy, were not examined. Because the muscle biopsies in the present study were obtained from the surgical site during elective surgery, it was not possible, for obvious reasons, to study limb girdle muscles or other muscles from the same patient, although the expression of troponins may vary between different muscle groups (21). Despite the increased serum cTnT concentration, none of the specimens showed any evidence of cTnT expression, neither at the RNA nor at the protein level.

No history of myopathic symptoms was available. Because uremic myopathy mostly affects proximal limb girdle muscles, which were not sampled in the present study, we theoretically could have missed the expression of cTnT in muscle groups that may be more likely to reveal extracardiac cTnT expression. Because the surgical muscle biopsies were not subjected to routine light-microscopy examination, we cannot comment on histopathological evidence of myopathy. It should be noted, however, that the prevalence of an increased cTnT concentration in the blood of dialysis patients is higher than the incidence of clinical uremic myopathy. Therefore, clinical myopathy alone may not explain the increased cTnT concentrations in the blood of dialysis patients. Moreover, parathyroid hormone as a marker for musculoskeletal uremic disease was not different between the patient groups in the present study. Therefore, it appears that blood concentrations of cTnT may be increased in dialysis patients in the absence of myopathy.

The absence of extracardiac cTnT expression in truncal skeletal muscle lends additional support to the hypothesis that the cTnT found in the serum of a substantial subgroup of hemodialysis patients originates from the heart. The clinical importance of this finding is not clear, but it could be speculated that the low-level release of cTnT from cardiac myocytes signifies cardiac cell injury in the setting of the poorly defined "uremic cardiomyopathy". Further studies are warranted to test the hypothesis that the serum concentration of cTnT could be clinically useful to identify a subpopulation of dialysis patients with high cardiac risk.


   Acknowledgments
 
We acknowledge the excellent technical assistance of G. Müller. We thank A. Koch from the Institute of Biostatistics at the University of Heidelberg for help with the statistical evaluation of the data. We also thank E. Ritz for critical reading of the manuscript. This research was funded in part by grants from the German Research Council and from Boehringer Mannheim Corp (H.A.K.).


   Footnotes
 
1 Nonstandard abbreviations: ESRD, end-stage renal disease; CAD, coronary artery disease; cTnT, cardiac troponin T; RT-PCR, reverse transcription-PCR; SDS, sodium dodecyl sulfate; and CK, creatine kinase.

Part of this work was presented at the 1997 American College of Cardiology meeting in Anaheim, CA.


   References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 

  1. Raine AE, Margreiter R, Brunner FP, Ehrich JH, Geerlings W, Landais P. Report on management of renal failure in Europe XXII. Nephrol Dial Transplant 1992;7:7-35.
  2. Rostand SG, Kirk KA, Rutsky EA. Dialysis-associated ischemic heart disease. Kidney Int 1984;25:653-659. [Web of Science][Medline] [Order article via Infotrieve]
  3. Lemos JA, Hillis LD. Diagnosis and management of coronary artery disease in patients with end-stage renal disease on hemodialysis. J Amer Soc Nephrol 1996;7:2044-2054. [Abstract]
  4. Farah CS, Reinach FC. The troponin complex and regulation of muscle contraction. FASEB J 1995;9:755-767. [Abstract]
  5. Hamm CW, Katus HA. New biochemical markers for myocardial cell injury. Curr Opin Cardiol 1995;10:355-360. [Web of Science][Medline] [Order article via Infotrieve]
  6. Katus HA, Scheffold T, Remppis A, Zehelein J. Proteins of the troponin complex. Lab Med 1992;23:311-317. [Web of Science]
  7. Breitbart RE, Nadal-Ginard B. Complete nucleotide sequence of the fast skeletal troponin T gene: alternatively spliced exons exhibit unusual interspecies divergence. J Mol Biol 1986;188:313-314. [Web of Science][Medline] [Order article via Infotrieve]
  8. Baldwin AS, Kittler ELW, Emerson CP. Structure, evolution, and regulation of a fast skeletal muscle troponin I gene. Proc Natl Acad Sci U S A 1985;82:8080-8084. [Abstract/Free Full Text]
  9. Gao L, Kennedy JM, Solaro RJ. Differential expression of TnI and TnT isoforms in rabbit heart during the perinatal period and during cardiovascular stress. J Mol Cell Cardiol 1995;27:541-550. [Web of Science][Medline] [Order article via Infotrieve]
  10. Wade R, Kedes L. Developmental regulation of contractile protein genes. Ann Rev Physiol 1989;51:179-188. [Web of Science][Medline] [Order article via Infotrieve]
  11. Bodor GS, Porterfield D, Voss EM, Smith S, Apple FS. Cardiac troponin-I is not expressed in fetal and healthy or diseased adult human skeletal muscle tissue. Clin Chem 1995;41:1710-1715. [Abstract]
  12. Rottbauer W, Greten T, Müller-Bardorff M, Remppis A, Zehelein J, Grünig E, et al. Troponin T: a diagnostic marker for myocardial infarction and minor cardiac cell damage. Eur Heart J 1996;17:3-8. [Free Full Text]
  13. Adams JE, Bodor GS, Davila-Roman V, Delmez JA, Apple FS, Ladenson JH, et al. Cardiac Troponin I: a marker with high specificity for cardiac injury. Circulation 1993;88:101-106. [Abstract/Free Full Text]
  14. Bhayana V, Gougoulias T, Cohoe S, Henderson AR. Discordance between results for serum troponin T and troponin I in renal disease. Clin Chem 1995;41:312-317. [Abstract/Free Full Text]
  15. Li D, Jialal I, Keffer J. Greater frequency of increased cardiac troponin T than increased cardiac troponin I in patients with chronic renal failure. Clin Chem 1996;42:114-115. [Free Full Text]
  16. Hafner G, Thome-Kromer B, Schaube J, Kupferwasser I, Ehrenthal W, Cummins P, et al. Cardiac troponins in serum in chronic renal failure. Clin Chem 1994;40:1790-1791. [Free Full Text]
  17. McLaurin MD, Apple FS, Herzog CA, Sharkey SW. Cardiac troponin I, T and CK-MB in chronic hemodialysis patients [Abstract]. Circulation 1995;92:380.[Abstract/Free Full Text]
  18. Baum H, Wayand D, Schaerf J, Obst M, Neumeier D. Comparison of two cardiac troponin T assays and one troponin I assay in patients with end-stage renal failure [Abstract]. Clin Chem 1996;42:S122.
  19. Scheffold T, Sodemann K, Köster W, März W, Wieland H, Hodenberg E v. Serumkonzentrationen von Troponin-I und Troponin-T, Kreatinkinase MB und Myoglobin bei Hämodialyse-Patienten [Abstract]. Z Kardiol 1997;86:700.
  20. Möckel M, Schindler R, Knorr L, Müller C, Danne O, Klefisch F, et al. Erhöhung verschiedener kardialer Troponin bei Patienten mit Niereninsuffizienz ohne akutes koronares Syndrom [Abstract]. Z Kardiol 1997;86:1250.
  21. Bodor GS, Survant L, Voss EM, Smith S, Porterfield D, Apple FS. Cardiac troponin T composition in normal and regenerating human skeletal muscle. Clin Chem 1997;43:476-484. [Abstract/Free Full Text]
  22. Kobayashi S, Tanaka M, Tamura N, Hashimoto H, Hirose S. Serum cardiac troponin T in polymyositis dermatomyositis [Letter]. Lancet 1992;340:726.[Web of Science][Medline] [Order article via Infotrieve]
  23. Saggin L, Gorza L, Ausoni S, Schiffano S. Cardiac troponin T in developing, regenerating, and denervated rat skeletal muscle. Development 1990;110:547-554. [Abstract/Free Full Text]
  24. Haller C, Stevanovich A, Katus HA. Are cardiac troponins reliable serodiagnostic markers of cardiac ischaemia in end-stage renal disease?. Nephrol Dial Transplant 1996;11:941-944. [Free Full Text]
  25. Katus HA, Haller C, Müller-Bardorff M, Scheffold T, Remppis A. Cardiac troponin T in end-stage renal disease patients undergoing chronic maintenance hemodialysis. Clin Chem 1995;41:1201-1202. [Free Full Text]
  26. McLaurin MD, Apple FS, Voss EM, Herzog CA, Sharkey SW. Cardiac troponin I, cardiac troponin T, and creatine kinase MB in dialysis patients without heart disease: evidence of cardiac troponin T expression in skeletal muscle. Clin Chem 1997;43:976-982. [Abstract/Free Full Text]
  27. Haller C, Katus HA. Cardiac troponin T in dialysis patients [Letter]. Clin Chem 1998;44:358.[Free Full Text]
  28. Katus HA, Looser S, Hallermayer K, Remppis A, Scheffold T, Borgya A, et al. Development and in vitro characterization of a new immunoassay of cardiac troponin T. Clin Chem 1992;38:386-393. [Abstract/Free Full Text]
  29. Müller-Bardorff M, Hallermayer K, Schröder A, Ebert C, Borgya A, Gerhardt W, et al. Improved troponin T ELISA specific for cardiac troponin T isoform: assay development and analytical and clinical validation. Clin Chem 1997;43:458-466. [Abstract/Free Full Text]
  30. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979;18:5294-5299. [Medline] [Order article via Infotrieve]
  31. Gahlmann R, Troutt AB, Wade RP, Gunning P, Kedes L. Alternative splicing generates variants in important functional domains of human slow skeletal troponin T. J Biol Chem 1987;262:16122-16126. [Abstract/Free Full Text]
  32. Mesnard L, Samson F, Espinasse I, Durand J, Neveux JY, Mercadier JJ. Molecular cloning and developmental expression of human cardiac troponin T. FEBS Lett 1993;328:139-144. [Web of Science][Medline] [Order article via Infotrieve]
  33. Lämmli EK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970;227:680-685. [Medline] [Order article via Infotrieve]
  34. Katus HA, Remppis A, Looser S, Hallermayer K, Scheffold T, Kübler W. Enzyme-linked immunoassay of cardiac troponin T for the detection of acute myocardial infarction in patients. J Mol Cell Cardiol 1989;21:1349-1353. [Web of Science][Medline] [Order article via Infotrieve]
  35. Katus HA, Remppis A, Looser S, Hallermayer K, Scheffold T, Kübler W. Diagnostic efficiency of troponin T measurements in acute myocardial infarction. Circulation 1991;83:902-902. [Abstract/Free Full Text]
  36. Hamm CW, Ravkilde J, Gerhardt W, Jorgensen P, Peheim E, Ljungdahl L, et al. The prognostic value of serum troponin T in unstable angina. N Engl J Med 1992;327:146-150. [Abstract]
  37. Katus HA, Schoeppenthau M, Tanzeem A, Bauer HG, Saggau W, Diederich KW, et al. Non-invasive assessment of perioperative myocardial cell damage by circulating cardiac troponin T. Br Heart J 1991;65:259-264. [Abstract/Free Full Text]
  38. Amann K, Ritz E. Cardiac structure and function in renal disease. Curr Opin Nephrol Hypertens 1996;5:102-106. [Medline] [Order article via Infotrieve]
  39. Törnig J, Amann K, Ritz E, Nichols C, Zeier M, Mall G. Arteriolar thickening, capillary rarefaction and interstitial fibrosis in the heart of rats with renal failure: the effects of ramipril, nifedipine and moxonidine. J Am Soc Nephrol 1996;7:667-675. [Abstract]
  40. Amann K, Neusüss R, Ritz E, Irzyniec T, Wiest G, Mall G. Changes of vascular architecture independent of blood pressure in experimental uremia. Am J Hypertens 1995;8:409-417. [Web of Science][Medline] [Order article via Infotrieve]
  41. Jabs K, Rifai N, Colan SD, Galpachian V, Lipshultz SE. Elevations of serum troponin T (TnT) and I (TnI) levels and cardiac abnormalities in children with chronic renal failure (CRF) [Abstract]. J Amer Soc Nephrol 1996;7:1320.
  42. Anderson PAW, Greig A, Mark TM, Malouf NN, Oakeley AE, Ungerleider RM, et al. Molecular basis of human cardiac troponin T isoforms expressed in the developing, adult, and failing heart. Circulation 1995;76:681-686.
  43. Anderson PAW, Malouf NM, Oakeley AE, Pagani ED, Allen PD. Troponin T isoform expression in humans. A comparison among normal and failing adult heart, fetal heart, and adult and fetal skeletal muscle. Circ Res 1991;69:1226-1233. [Abstract/Free Full Text]
  44. Conjard A, Ferrier B, Martin M. Effects of chronic renal failure on enzymes of energy metabolism in individual human muscle fibers. J Am Soc Nephrol 1995;6:68-74. [Abstract]



The following articles in journals at HighWire Press have cited this article:


Home page
HeartHome page
S. Korff, H. A Katus, and E. Giannitsis
Differential diagnosis of elevated troponins.
Heart, July 1, 2006; 92(7): 987 - 993.
[Full Text] [PDF]


Home page
CirculationHome page
N. A. Khan, B. R. Hemmelgarn, M. Tonelli, C. R. Thompson, and A. Levin
Prognostic Value of Troponin T and I Among Asymptomatic Patients With End-Stage Renal Disease: A Meta-Analysis
Circulation, November 15, 2005; 112(20): 3088 - 3096.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
D. Duman, S. Tokay, A. Toprak, D. Duman, A. Oktay, and I. C. Ozener
Elevated cardiac troponin T is associated with increased left ventricular mass index and predicts mortality in continuous ambulatory peritoneal dialysis patients
Nephrol. Dial. Transplant., May 1, 2005; 20(5): 962 - 967.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
K. B. Wallace, E. Hausner, E. Herman, G. D. Holt, J. T. Macgregor, A. L. Metz, E. Murphy, I.Y. Rosenblum, F. D. Sistare, and M. J. York
Serum Troponins as Biomarkers of Drug-Induced Cardiac Toxicity
Toxicol Pathol, January 1, 2004; 32(1): 106 - 121.
[PDF]


Home page
HeartHome page
P O Collinson and P J Stubbs
Are troponins confusing?
Heart, November 1, 2003; 89(11): 1285 - 1287.
[Full Text] [PDF]


Home page
PediatricsHome page
S. E. Lipshultz, M. J. G. Somers, S. R. Lipsitz, S. D. Colan, K. Jabs, and N. Rifai
Serum Cardiac Troponin and Subclinical Cardiac Status in Pediatric Chronic Renal Failure
Pediatrics, July 1, 2003; 112(1): 79 - 86.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
C. W. Hamm, E. Giannitsis, and H. A. Katus
Cardiac Troponin Elevations in Patients Without Acute Coronary Syndrome
Circulation, December 3, 2002; 106(23): 2871 - 2872.
[Full Text] [PDF]


Home page
CirculationHome page
F. S. Apple, M. M. Murakami, L. A. Pearce, and C. A. Herzog
Predictive Value of Cardiac Troponin I and T for Subsequent Death in End-Stage Renal Disease
Circulation, December 3, 2002; 106(23): 2941 - 2945.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
C. Lowbeer, A. Gutierrez, S. A. Gustafsson, R. Norrman, J. Hulting, and A. Seeberger
Elevated cardiac troponin T in peritoneal dialysis patients is associated with CRP and predicts all-cause mortality and cardiac death
Nephrol. Dial. Transplant., December 1, 2002; 17(12): 2178 - 2183.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. S. Jaffe
Testing the wrong hypothesis: the failure to recognize the limitations of troponin assays
J. Am. Coll. Cardiol., October 1, 2001; 38(4): 999 - 1001.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
M. C. Iliou, C. Fumeron, M. O. Benoit, P. Tuppin, C. L. Courvoisier, V. M. Calonge, N. Moatti, C. Buisson, and C. Jacquot
Factors associated with increased serum levels of cardiac troponins T and I in chronic haemodialysis patients: Chronic Haemodialysis And New Cardiac Markers Evaluation (CHANCE) study
Nephrol. Dial. Transplant., July 1, 2001; 16(7): 1452 - 1458.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. Fredericks, J. F. Murray, M. Bewick, R. Chang, P. O. Collinson, N. D. Carter, and D. W. Holt
Cardiac Troponin T and Creatine Kinase MB Are Not Increased in Exterior Oblique Muscle of Patients with Renal Failure
Clin. Chem., June 1, 2001; 47(6): 1023 - 1030.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
G. K. Davis, R. Labugger, J. E. Van Eyk, and F. S. Apple
Cardiac Troponin T Is Not Detected in Western Blots of Diseased Renal Tissue
Clin. Chem., April 1, 2001; 47(4): 782 - 783.
[Full Text] [PDF]


Home page
Clin. Chem.Home page
A. Hammerer-Lercher, P. Erlacher, R. Bittner, R. Korinthenberg, D. Skladal, S. Sorichter, W. Sperl, B. Puschendorf, and J. Mair
Clinical and Experimental Results on Cardiac Troponin Expression in Duchenne Muscular Dystrophy
Clin. Chem., March 1, 2001; 47(3): 451 - 458.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. Dierkes, U. Domrose, S. Westphal, A. Ambrosch, H.-P. Bosselmann, K. H. Neumann, and C. Luley
Cardiac Troponin T Predicts Mortality in Patients With End-Stage Renal Disease
Circulation, October 17, 2000; 102(16): 1964 - 1969.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
D. Wayand, H. Baum, G. Schatzle, J. Scharf, and D. Neumeier
Cardiac Troponin T and I in End-Stage Renal Failure
Clin. Chem., September 1, 2000; 46(9): 1345 - 1350.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
N. Frey, W. M. Franz, K. Gloeckner, M. Degenhardt, M. Muller, O. Muller, H. Merz, and H. A. Katus
Transgenic rat hearts expressing a human cardiac troponin T deletion reveal diastolic dysfunction and ventricular arrhythmias
Cardiovasc Res, August 1, 2000; 47(2): 254 - 264.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
S. Fredericks, P. O. Collinson, D. W. Holt, P. A. Isotalo, D. C. Greenway, and J. G. Donnelly
Response to ""Increased Creatine Kinase MB and Cardiac Troponin T with Normal Cardiac Troponin I in Metastatic Alveolar Rhabdomyosarcoma"" • The authors of the Letter cited above reply:
Clin. Chem., March 1, 2000; 46(3): 432 - 435.
[Full Text] [PDF]


Home page
Clin. Chem.Home page
V. Ricchiuti and F. S. Apple
RNA Expression of Cardiac Troponin T Isoforms in Diseased Human Skeletal Muscle
Clin. Chem., December 1, 1999; 45(12): 2129 - 2135.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
P. A. Isotalo, D. C. Greenway, and J. G. Donnelly
Metastatic Alveolar Rhabdomyosarcoma with Increased Serum Creatine Kinase MB and Cardiac Troponin T and Normal Cardiac Troponin I
Clin. Chem., September 1, 1999; 45(9): 1576 - 1578.
[Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
C. Lowbeer, A. Ottosson-Seeberger, S. A. Gustafsson, R. Norrman, J. Hulting, and A. Gutierrez
Increased cardiac troponin T and endothelin-1 concentrations in dialysis patients may indicate heart disease
Nephrol. Dial. Transplant., August 1, 1999; 14(8): 1948 - 1955.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
J. C. Stolear, B. Georges, A. Shita, and D. Verbeelen
The predictive value of cardiac troponin T measurements in subjects on regular haemodialysis
Nephrol. Dial. Transplant., August 1, 1999; 14(8): 1961 - 1967.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
A. H.B. Wu, F. S. Apple, W. B. Gibler, R. L. Jesse, M. M. Warshaw, and R. Valdes Jr.
National Academy of Clinical Biochemistry Standards of Laboratory Practice: Recommendations for the Use of Cardiac Markers in Coronary Artery Diseases
Clin. Chem., July 1, 1999; 45(7): 1104 - 1121.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
D. J. Newman, Y. Olabiran, W. D. Bedzyk, S. Chance, E. G. Gorman, and C. P. Price
Impact of Antibody Specificity and Calibration Material on the Measure of Agreement between Methods for Cardiac Troponin I
Clin. Chem., June 1, 1999; 45(6): 822 - 828.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
A. R. McNeil, M. Marshall, C. J. Ellis, and R. C. Hawkins
Why is Troponin T Increased in the Serum of Patients with End-Stage Renal Disease?
Clin. Chem., November 1, 1998; 44(11): 2377 - 2378.
[Full Text]


Home page
Clin. Chem.Home page
V. Ricchiuti, E. M. Voss, A. Ney, M. Odland, P. A. W. Anderson, and F. S. Apple
Cardiac troponin T isoforms expressed in renal diseased skeletal muscle will not cause false-positive results by the second generation cardiac troponin T assay by Boehringer Mannheim
Clin. Chem., September 1, 1998; 44(9): 1919 - 1924.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (81)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Haller, C.
Right arrow Articles by Katus, H. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Haller, C.
Right arrow Articles by Katus, H. A.
Related Collections
Right arrow Proteomics and Protein Markers


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS