|
|
||||||||
Enzymes and Protein Markers |
1
Department of Medicine III, University of Heidelberg, 69115 Heidelberg, Germany.
2
Department of Medicine II, University of Lübeck,
23538 Lübeck, Germany.
a Address correspondence to this author at: Department of Internal Medicine II, University of Lübeck, Ratzeburger Allee 160, D-23538 Lübeck Germany. Fax 49-451-5006437.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
All patients had a 2D-echocardiographic examination within 6 months before the study. For analysis of the data, the patients were stratified into three groups according to their likelihood of having CAD: group A, patients with known CAD (previous myocardial infarction and/or >50% stenosis of at least one major coronary artery at coronary angiography); group B, patients with two or more recognized major risk factors for CAD in addition to ESRD (smoking, hypertension, diabetes, or hypercholesterolemia); or group C, patients with one or no other coronary risk factor except ESRD.
expression of cTnT in skeletal muscle
Five patients with ESRD (all with an increased plasma
concentration of cTnT; 0.255.32 µg/L, first generation assay) and
one control patient with healthy renal function (living related donor
for kidney transplantation; plasma cTnT, 0.07 µg/L, first generation
assay) underwent elective surgery. Skeletal muscle specimens were
obtained from the operation site (abdominal wall or back muscles) under
direct vision while the patients were under general anesthesia. The
tissue samples were divided in the operating room into two aliquots:
One aliquot was snap-frozen in liquid nitrogen; the other aliquot was
immediately immersion-fixed in 30 g/L paraformaldehyde and 10 g/L
glutaraldehyde in phosphate-buffered saline (140 mmol/L sodium
chloride, 4 mmol/L sodium phosphate, 1.5 mmol/L potassium phosphate,
and 2.7 mmol/L potassium chloride), pH 7.4. All chemicals were
purchased from Sigma Chemical Co. unless indicated otherwise.
reverse transcriptionpcr (rt-pcr) of troponin t in skeletal
muscle
Total RNA was isolated from the snap-frozen muscle biopsy
specimens according to the method of Chirgwin et al.
(30). One hundred milligrams of the muscle tissue
yielded ~80 µg of RNA. The RNA was reverse transcribed using M-MLV
reverse transcriptase (Life Technologies) according to the supplier's
protocol. The reverse-transcribed cDNAs were amplified by PCR using the
following oligonucleotide primers:
(a) human slow skeletal muscle troponin T amplification (31),
forward: CCTCGAGATTCACAGCATCTC
reverse: AGCTGCAGCAGGTCTTTCTC; or
(b) human cTnT amplification (32),
forward: GGAGAGCAGAGACCATGT
reverse: ACTCTCTCTCCATCGGGGATC.
The amplified DNA fragments were visualized by agarose gel electrophoresis combined with ethidium bromide staining.
immunoblot
Frozen muscle specimens were ultrasonically lysed in 50 mmol/L
KCl, 2 mol/L urea, 50 mmol/L Tris-HCl, pH 7.5, and immediately
transferred into sodium dodecyl sulfate (SDS) sample buffer
(33), boiled for 15 seconds, and subjected to
SDS-polyacrylamide gel (15%) electrophoresis. The separated proteins
were electrophoretically blotted onto a polyvinylidene difluoride
membrane (Millipore), using a semidry transfer apparatus.
The membranes were blocked with 30 g/L casein in incubation buffer (150 mmol/L NaCl, 10 mmol/L Tris-HCl, 10 g/L Tween 20, pH 8) for 1 h at room temperature. The membranes were then incubated for 1 h at room temperature with a mouse monoclonal antibody (1B10) that recognizes both the skeletal and cardiac muscle isoforms of human troponin T (34) at a dilution of 1:10 000. Alkaline phosphatase-conjugated goat anti-mouse IgG (Dianova) was used at a dilution of 1:20 000 for the detection of specific antibody binding with a chemoluminescence kit (Tropix) and an exposure time of 10 min. The cardiac and skeletal muscle isoforms could be discerned by their different molecular masses by means of their distinctive migration pattern on SDS-polyacrylamide gel electrophoresis. For both the RT-PCR and immunoblot experiments, postmortem human myocardium was used as a positive control. The cardiac specimen of a previously healthy, violent crime victim was obtained 6 h postmortem from the Department of Forensic Pathology at the University of Heidelberg.
indirect immunofluorescence
Small pieces of immersion-fixed skeletal muscle were epon-embedded
and sectioned with an ultramicrotome. Epon sections (0.5 µm) on
microscopy slides were blocked at room temperature with 10 g/L bovine
serum albumin and 0.5 g/L saponin in phosphate-buffered saline, pH 7.4,
for 20 min. The sections were incubated with cTnT-specific mouse
monoclonal antibody 1H10 overnight at 4 °C at a dilution of 1:5000
in blocking buffer. After the sections were washed with
phosphate-buffered saline, they were incubated for 1 h at room
temperature in Cy3-conjugated anti-mouse IgG (Dianova). Immersion-fixed
right ventricular biopsies from cardiac transplant recipients were used
as positive controls. The muscle sections were examined with a Zeiss
photomicroscope.
cTnT measurement in blood
Plasma samples derived from EDTA-treated blood obtained during
routine monthly predialysis blood draws were stored at -20 °C for
later batch analysis of the cTnT concentration. cTnT was measured in
plasma using a first (35) and a second generation
(29) cTnT sandwich ELISA and an ES 300 (Boehringer
Mannheim). A discriminator value of 0.2 µg/L was chosen in the first
generation assay (35); 0.15 µg/L was the cutoff value in
the second generation assay. Total creatine kinase (CK) activity was
measured in the clinical chemistry laboratory of the University of
Heidelberg Medical School, using a standard colorimetric assay
(Beckmann).
statistical analysis
All measurements are presented as median and quartiles denoting
the 25th and the 75th percentile of the distribution. The overall
differences between the cTnT concentrations in the three patient groups
(global hypothesis) were tested with the nonparametric KruskalWallis
test. Because there was a significant difference (P <0.01)
between the groups, pairwise comparisons were carried out with the
nonparametric Wilcoxon signed rank test.
The prevalence of increased cTnT values (
0.2 µg/L, first generation
assay;
0.15 µg/L, second generation assay) in the different patient
groups was compared using contingency table analysis. Contingency table
analysis over the three groups rejected the global hypothesis that
there was no difference between the groups. Therefore, pairwise
comparisons of the groups were carried out using contingency
table analysis with continuity correction.
| Results |
|---|
|
|
|---|
|
|
The results of a representative immunofluorescence experiment on a
truncal skeletal muscle specimen from a hemodialysis patient with a
serum troponin T concentration of 0.41 µg/L (first generation assay)
is shown in Fig. 3
. The mouse monoclonal antibody specific for the cardiac isoform
of human troponin T (1H10) failed to stain the skeletal muscle sections
of the uremic patient (data not shown), whereas there was specific
sarcomeric staining for cTnT in human cardiac control tissue. The
cardiac-specific antibody also failed to bind to the truncal skeletal
muscle of four other patients with ESRD who had serum cTnT
concentrations of 0.37, 5.32, 0.25, and 0.5 µg/L (first generation
assay).
|
The measurements of cTnT in the blood of 97 patients on chronic
maintenance hemodialysis showed that cTnT is detectable in a
substantial subgroup of these patients. Table 1
shows the demographic characteristics of the hemodialysis
patients from the two dialysis centers. Patient age and comorbidity
were similar in the two centers. The patients were stratified into
three groups according to cardiac risk (Table 2
). There were no major differences between the three patient
groups with regards to renal diagnosis, duration of hemodialysis, or
dialysis protocols/efficiency. However, because of the stratification
criteria, the prevalence of cardiac risk factors was lower in group C.
Because the patients in group C were younger and generally less sick,
it can be inferred that the medications were different between the
groups. No history of uremic myopathy was available, but there
was no difference in the serum parathyroid hormone concentrations that
are generally regarded as a marker for uremic musculoskeletal disease.
The prevalence of cardiac risk factors was similar in groups A and B,
and most patients in these two groups had echocardiographic evidence of
concentric left ventricular hypertrophy.
|
|
When the serum samples were analyzed with the first generation cTnT
ELISA, 39% of the patients had a serum concentration of cTnT
0.2
µg/L, which is the upper limit of the reference interval determined
in patients with intact renal function. At the chosen cutoff value of
the second generation cTnT ELISA (cTnT
0.15 µg/L), 29% of the
dialysis patients had an increased serum concentration, but only 24%
exceeded 0.2 µg/L. The increase in serum concentration of cTnT did
not correlate with the patients' age or sex, the duration of
hemodialysis, the cause of renal failure, residual urine production, or
indicators of dialysis efficiency, such as pre- and postdialysis blood
urea nitrogen concentrations, ß2-microglobulin
concentrations, parathyroid hormone concentrations, or nutritional
status (data not shown).
As can be seen in Table 3
), in both the first and the second generation cTnT assays, the
prevalence of increased cTnT concentrations correlated with cardiac
risk, as indicated by the significant difference between groups A and C
(P = 0.0196 in the first generation assay and
P = 0.0074 in the second generation assay). There was a
trend towards a difference between groups B and C, which reached
borderline significance (P = 0.0510) in the first
generation cTnT assay.
|
Table 4
shows the median cTnT concentration in the three groups. In
both assays, the patients in group A with established CAD had a
significantly higher median plasma concentration of cTnT compared with
patients in the low risk group C. The median cTnT concentration in
group B was similar to that of group A, but significantly different
from group C.
|
| Discussion |
|---|
|
|
|---|
0.2 µg/L) in 39% (first
generation cTnT ELISA) of a large and representative population of
hemodialysis patients. When the second generation cTnT ELISA was used,
29% of the hemodialysis patients had increased cTnT concentrations,
even when a cutoff value (
0.15 µg/L) higher than the discriminator
value recommended for patients without renal failure (
0.1 µg/L)
(29) was used. The higher discriminator value was chosen to
increase the specificity of the measurement with the second generation
cTnT ELISA. Although the reasons for the increased cTnT concentrations in the blood of dialysis patients without clinical evidence of myocardial cell injury are not clear, the present results are consistent with the hypothesis that the cTnT measured in the blood of dialysis patients may be of cardiac origin. The two main findings of the present study are the absence of cTnT expression in the truncal skeletal muscle of five hemodialysis patients with an increased serum cTnT concentration and the correlation between the plasma cTnT concentration and indicators of CAD.
cTnT assays
cTnT has been systematically evaluated as a serodiagnostic tool
for myocardial cell injury in patients without renal disease
(12). Specific monoclonal antibodies that do not
cross-react with extracardiac TnT isoforms are available and have been
extensively characterized (28). The sensitivity and
specificity of assays using cTnT as a diagnostic marker has been
demonstrated in a variety of clinical settings, such as acute
myocardial infarction (35), unstable angina (36),
and perioperative myocardial infarction (37), which poses a
particular challenge for a test to differentiate between skeletal and
cardiac muscle cell injury.
In patients with end-stage renal diseasea population with a high prevalence of ischemic heart diseasethe diagnostic performance of cTnT as a serodiagnostic marker for myocardial ischemia has not been systematically evaluated. Several case reports and reports from small patient series have suggested that cTnT concentrations may be increased in the serum of hemodialysis patients without myocardial ischemia (14)(15)(16)(17). In theory, this could be a laboratory artifact of the cTnT assay in the presence of uremic serum. Interferences between uremic serum and the cTnT assay have not been evaluated. However, the theoretical possibility of artifactual interference between blood factors present only in dialysis patients and cTnT measurements is not likely because there was no apparent correlation between dialysis duration, residual urine production, and other standard indicators of dialysis efficiency. Only a subgroup of patients had increased cTnT concentrations, whereas other patients exhibited no increase in serum cTnT concentrations despite a similar uremic/dialytic state. Thus, neither the uremic state itself nor the hemodialysis procedure accounts for the increased cTnT values; rather, some patient-related factor appears to be involved. Both the first and second generation cTnT assays yielded a high prevalence of increased serum cTnT concentrations, even when the discriminator value of the second generation assay was adjusted from the recommended value of 0.1 µg/L in patients without renal disease to 0.15 µg/L in patients with ESRD. This argues against the interpretation that an increased cTnT concentration in dialysis patients merely represents an assay artifact, because the newer assay with a different antibody combination and an increased specificity (29) produced a prevalence of increased cTnT concentrations similar to that of the first generation assay. Thus, it is not unreasonable to speculate that both assays measure cTnT circulating in the blood of a substantial subgroup of hemodialysis patients.
correlation with cardiac risk factors
We hypothesized that the increased cTnT concentration in the serum
of some dialysis patients might be related to subclinical myocardial
cell injury, which could occur during the hemodynamic "stress" of
hemodialysis. cTnT has a serum half-life of 1.5 h in patients
without renal failure. Hence, the increased steady-state concentration
of cTnT in the serum of some patients with ESRD could be a cumulative
result of (repetitive) subclinical myocardial cell injury during
hemodialysis.
Our results show a correlation between the cTnT concentration measured with the first generation cTnT assay and indicators of CAD. This is consistent with the hypothesis that the increased cTnT concentration may indeed be of cardiac origin. Hence, the high sensitivity of the cTnT assay may allow the detection of subclinical myocardial cell injury in the setting of hemodialysis.
In addition to CAD, the uremic state itself could predispose the heart to myocardial cell injury. Experimental studies in uremic animals have shown a pronounced, blood pressure-independent microvascular rarefaction and fibrosis in cardiac muscle, which was presumed to be produced by chronic ischemia in the absence of epicardial stenotic lesions (38)(39)(40). It could be speculated that this structural alteration of cardiac muscle during uremia, especially when combined with hypertensive left-ventricular hypertrophy and/or CAD, could be the cause of subclinical, slowly ongoing cardiac cell damage that leads to the release of small amounts of cTnT into the circulation, which may be detected with the sensitive cTnT assays. In this context, it may be relevant that most of the patients in this study had echocardiographic evidence of left-ventricular hypertrophy, because echocardiographic abnormalities were associated with increased cTnT concentrations in a pediatric hemodialysis population (41). Taken together, the available data are consistent with the hypothesis that cTnT in the serum of dialysis patients is of cardiac origin rather than an assay artifact or a result of extracardiac expression. Nevertheless, to exclude the latter possibility, we investigated the expression of cTnT in skeletal muscle biopsies of hemodialysis patients.
absence of extracardiac expression of cTnT
The tightly regulated tissue-specific expression of cTnT
(42)(43) is the basis for its diagnostic
specificity as a marker for myocardial cell injury. Unlike the
conventional cardiac enzymes, cTnT is undetectable with the available
assays in the serum under nonischemic conditions in patients without
renal failure. Thus, no ambiguity exists in the interpretation of cTnT
serum concentrations, because circulating cTnT necessarily derives from
injured cardiomyocytes unless there is extracardiac expression of cTnT
in skeletal muscle. Because of the large mass of skeletal muscle and
the propensity for minor trauma during daily activities, the expression
of cTnT in uremic skeletal muscle could evidently explain an increased
steady-state serum concentration of cTnT. It has been reported that
injured or regenerating skeletal muscle can express different protein
isoforms compared with quiescent/fully differentiated muscle. Recent
work has demonstrated decreased enzymatic activities in
energy-providing metabolic pathways in uremic patients (44).
The extracardiac expression of cTnT in injured or diseased skeletal
muscle has been reported in animals (23) and in humans with
polymyositis/dermatomyositis (22). Recently McLaurin et al.
(26) reported evidence of cTnT expression in skeletal muscle
of dialysis patients. However, this evidence is not conclusive for a
variety of reasons (27). These authors used an anti-cTnT
antibody that reportedly cross-reacted with some human skeletal muscle
troponin T isoforms. The reduced specificity of the antibody and the
low resolution of the immunoblot shown in their article limit the
interpretation that cTnT may be expressed in the skeletal muscle of
dialysis patients.
In our study, we used a specific antibody against the cardiac isoform of troponin T, which did not react with skeletal muscle tissue but showed a specific band in cardiac control tissue. One limitation of both the present study and the study performed by McLaurin et al. is that proximal extremity muscles, which are the most common target of uremic myopathy, were not examined. Because the muscle biopsies in the present study were obtained from the surgical site during elective surgery, it was not possible, for obvious reasons, to study limb girdle muscles or other muscles from the same patient, although the expression of troponins may vary between different muscle groups (21). Despite the increased serum cTnT concentration, none of the specimens showed any evidence of cTnT expression, neither at the RNA nor at the protein level.
No history of myopathic symptoms was available. Because uremic myopathy mostly affects proximal limb girdle muscles, which were not sampled in the present study, we theoretically could have missed the expression of cTnT in muscle groups that may be more likely to reveal extracardiac cTnT expression. Because the surgical muscle biopsies were not subjected to routine light-microscopy examination, we cannot comment on histopathological evidence of myopathy. It should be noted, however, that the prevalence of an increased cTnT concentration in the blood of dialysis patients is higher than the incidence of clinical uremic myopathy. Therefore, clinical myopathy alone may not explain the increased cTnT concentrations in the blood of dialysis patients. Moreover, parathyroid hormone as a marker for musculoskeletal uremic disease was not different between the patient groups in the present study. Therefore, it appears that blood concentrations of cTnT may be increased in dialysis patients in the absence of myopathy.
The absence of extracardiac cTnT expression in truncal skeletal muscle lends additional support to the hypothesis that the cTnT found in the serum of a substantial subgroup of hemodialysis patients originates from the heart. The clinical importance of this finding is not clear, but it could be speculated that the low-level release of cTnT from cardiac myocytes signifies cardiac cell injury in the setting of the poorly defined "uremic cardiomyopathy". Further studies are warranted to test the hypothesis that the serum concentration of cTnT could be clinically useful to identify a subpopulation of dialysis patients with high cardiac risk.
| Acknowledgments |
|---|
| Footnotes |
|---|
Part of this work was presented at the 1997 American College of Cardiology meeting in Anaheim, CA.
| References |
|---|
|
|
|---|
The following articles in journals at HighWire Press have cited this article:
![]() |
S. Korff, H. A Katus, and E. Giannitsis Differential diagnosis of elevated troponins. Heart, July 1, 2006; 92(7): 987 - 993. [Full Text] [PDF] |
||||
![]() |
N. A. Khan, B. R. Hemmelgarn, M. Tonelli, C. R. Thompson, and A. Levin Prognostic Value of Troponin T and I Among Asymptomatic Patients With End-Stage Renal Disease: A Meta-Analysis Circulation, November 15, 2005; 112(20): 3088 - 3096. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Duman, S. Tokay, A. Toprak, D. Duman, A. Oktay, and I. C. Ozener Elevated cardiac troponin T is associated with increased left ventricular mass index and predicts mortality in continuous ambulatory peritoneal dialysis patients Nephrol. Dial. Transplant., May 1, 2005; 20(5): 962 - 967. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Wallace, E. Hausner, E. Herman, G. D. Holt, J. T. Macgregor, A. L. Metz, E. Murphy, I.Y. Rosenblum, F. D. Sistare, and M. J. York Serum Troponins as Biomarkers of Drug-Induced Cardiac Toxicity Toxicol Pathol, January 1, 2004; 32(1): 106 - 121. [PDF] |
||||
![]() |
P O Collinson and P J Stubbs Are troponins confusing? Heart, November 1, 2003; 89(11): 1285 - 1287. [Full Text] [PDF] |
||||
![]() |
S. E. Lipshultz, M. J. G. Somers, S. R. Lipsitz, S. D. Colan, K. Jabs, and N. Rifai Serum Cardiac Troponin and Subclinical Cardiac Status in Pediatric Chronic Renal Failure Pediatrics, July 1, 2003; 112(1): 79 - 86. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Hamm, E. Giannitsis, and H. A. Katus Cardiac Troponin Elevations in Patients Without Acute Coronary Syndrome Circulation, December 3, 2002; 106(23): 2871 - 2872. [Full Text] [PDF] |
||||
![]() |
F. S. Apple, M. M. Murakami, L. A. Pearce, and C. A. Herzog Predictive Value of Cardiac Troponin I and T for Subsequent Death in End-Stage Renal Disease Circulation, December 3, 2002; 106(23): 2941 - 2945. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lowbeer, A. Gutierrez, S. A. Gustafsson, R. Norrman, J. Hulting, and A. Seeberger Elevated cardiac troponin T in peritoneal dialysis patients is associated with CRP and predicts all-cause mortality and cardiac death Nephrol. Dial. Transplant., December 1, 2002; 17(12): 2178 - 2183. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Jaffe Testing the wrong hypothesis: the failure to recognize the limitations of troponin assays J. Am. Coll. Cardiol., October 1, 2001; 38(4): 999 - 1001. [Full Text] [PDF] |
||||
![]() |
M. C. Iliou, C. Fumeron, M. O. Benoit, P. Tuppin, C. L. Courvoisier, V. M. Calonge, N. Moatti, C. Buisson, and C. Jacquot Factors associated with increased serum levels of cardiac troponins T and I in chronic haemodialysis patients: Chronic Haemodialysis And New Cardiac Markers Evaluation (CHANCE) study Nephrol. Dial. Transplant., July 1, 2001; 16(7): 1452 - 1458. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fredericks, J. F. Murray, M. Bewick, R. Chang, P. O. Collinson, N. D. Carter, and D. W. Holt Cardiac Troponin T and Creatine Kinase MB Are Not Increased in Exterior Oblique Muscle of Patients with Renal Failure Clin. Chem., June 1, 2001; 47(6): 1023 - 1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Davis, R. Labugger, J. E. Van Eyk, and F. S. Apple Cardiac Troponin T Is Not Detected in Western Blots of Diseased Renal Tissue Clin. Chem., April 1, 2001; 47(4): 782 - 783. [Full Text] [PDF] |
||||
![]() |
A. Hammerer-Lercher, P. Erlacher, R. Bittner, R. Korinthenberg, D. Skladal, S. Sorichter, W. Sperl, B. Puschendorf, and J. Mair Clinical and Experimental Results on Cardiac Troponin Expression in Duchenne Muscular Dystrophy Clin. Chem., March 1, 2001; 47(3): 451 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dierkes, U. Domrose, S. Westphal, A. Ambrosch, H.-P. Bosselmann, K. H. Neumann, and C. Luley Cardiac Troponin T Predicts Mortality in Patients With End-Stage Renal Disease Circulation, October 17, 2000; 102(16): 1964 - 1969. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Wayand, H. Baum, G. Schatzle, J. Scharf, and D. Neumeier Cardiac Troponin T and I in End-Stage Renal Failure Clin. Chem., September 1, 2000; 46(9): 1345 - 1350. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Frey, W. M. Franz, K. Gloeckner, M. Degenhardt, M. Muller, O. Muller, H. Merz, and H. A. Katus Transgenic rat hearts expressing a human cardiac troponin T deletion reveal diastolic dysfunction and ventricular arrhythmias Cardiovasc Res, August 1, 2000; 47(2): 254 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fredericks, P. O. Collinson, D. W. Holt, P. A. Isotalo, D. C. Greenway, and J. G. Donnelly Response to ""Increased Creatine Kinase MB and Cardiac Troponin T with Normal Cardiac Troponin I in Metastatic Alveolar Rhabdomyosarcoma"" • The authors of the Letter cited above reply: Clin. Chem., March 1, 2000; 46(3): 432 - 435. [Full Text] [PDF] |
||||
![]() |
V. Ricchiuti and F. S. Apple RNA Expression of Cardiac Troponin T Isoforms in Diseased Human Skeletal Muscle Clin. Chem., December 1, 1999; 45(12): 2129 - 2135. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Isotalo, D. C. Greenway, and J. G. Donnelly Metastatic Alveolar Rhabdomyosarcoma with Increased Serum Creatine Kinase MB and Cardiac Troponin T and Normal Cardiac Troponin I Clin. Chem., September 1, 1999; 45(9): 1576 - 1578. [Full Text] [PDF] |
||||
![]() |
C. Lowbeer, A. Ottosson-Seeberger, S. A. Gustafsson, R. Norrman, J. Hulting, and A. Gutierrez Increased cardiac troponin T and endothelin-1 concentrations in dialysis patients may indicate heart disease Nephrol. Dial. Transplant., August 1, 1999; 14(8): 1948 - 1955. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Stolear, B. Georges, A. Shita, and D. Verbeelen The predictive value of cardiac troponin T measurements in subjects on regular haemodialysis Nephrol. Dial. Transplant., August 1, 1999; 14(8): 1961 - 1967. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H.B. Wu, F. S. Apple, W. B. Gibler, R. L. Jesse, M. M. Warshaw, and R. Valdes Jr. National Academy of Clinical Biochemistry Standards of Laboratory Practice: Recommendations for the Use of Cardiac Markers in Coronary Artery Diseases Clin. Chem., July 1, 1999; 45(7): 1104 - 1121. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Newman, Y. Olabiran, W. D. Bedzyk, S. Chance, E. G. Gorman, and C. P. Price Impact of Antibody Specificity and Calibration Material on the Measure of Agreement between Methods for Cardiac Troponin I Clin. Chem., June 1, 1999; 45(6): 822 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. McNeil, M. Marshall, C. J. Ellis, and R. C. Hawkins Why is Troponin T Increased in the Serum of Patients with End-Stage Renal Disease? Clin. Chem., November 1, 1998; 44(11): 2377 - 2378. [Full Text] |
||||
![]() |
V. Ricchiuti, E. M. Voss, A. Ney, M. Odland, P. A. W. Anderson, and F. S. Apple Cardiac troponin T isoforms expressed in renal diseased skeletal muscle will not cause false-positive results by the second generation cardiac troponin T assay by Boehringer Mannheim Clin. Chem., September 1, 1998; 44(9): 1919 - 1924. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |