Clinical Chemistry
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 45: 1683-1685, 1999;
This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, R. H.
Right arrow Articles by Wittliff, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, R. H.
Right arrow Articles by Wittliff, J. L.
Related Collections
Right arrow Oak Ridge Conference
Right arrow Endocrinology and Metabolism
Right arrow Automation and Analytical Techniques
(Clinical Chemistry. 1999;45:1683-1685.)
© 1999 American Association for Clinical Chemistry, Inc.


Oak Ridge Poster Sessions

Development of Kinetic Ligand-binding Assays Using a Fiber Optic Sensor

Richard H. Smith1,a, William J. Lemon1, Judith L. Erb1, John R. Erb-Downward1, James G. Downward1, Otho E. Ulrich1 and James L. Wittliff2

1 IA, Inc., Box 1306, Ann Arbor, MI, 48106, and
2 University of Louisville Medical School, Hormone Receptor Laboratory, Louisville, KY 40223-2211
a Author for correspondence: fax 734-995-6869,

Ligand-binding assays are ubiquitous in biochemical research and clinical determinations. In most common assay methods, binding proceeds until an equilibrium condition has been obtained, which leads to relatively long incubation times. The requirement for separating bound from free reagents in the reaction mixture before signal detection precludes direct observation of binding events. To reduce the duration of an assay and to facilitate kinetic analysis, methods based on evanescent field technology have recently been used in assay development. These include fiber optic fluorometric sensors (1)(2)(3) and surface plasmon resonance (4). Specifically, evanescent field technology is based on the observation that when light travels through a waveguide at angles approaching the critical angle for total internal reflection, an evanescent field is produced on the surface of the waveguide. This field falls off exponentially with distance from the surface and is exquisitely sensitive to the refractive indices of the waveguide surface and the medium in which the surface resides. In surface plasmon resonance, this sensitivity to refractive index is used to measure the amount of substance that binds to the waveguide surface. In evanescent field fluorometry, the field stimulates fluorophores, which become attached to the surface through specific binding interactions (2). We describe here the use of evanescent fiber optic fluorometric sensors to characterize ligand binding of IgG and monovalent Fab, both specific for estrone-1-glucuronide (E1g), and of the human estrogen receptor {alpha} (hER-{alpha}) to fibers bearing E1g or the specific estrogen response element (ERE) and demonstrate the determination of apparent association and dissociation binding constants.

Fused silica optical fibers obtained from Polymicro Technologies were cleaved in 11.5-cm lengths, and the cladding was removed from a 7.0-cm portion of the fiber using FluorinertTM (3 M). To assess the binding kinetics of IgG, Fab, and hER-{alpha}, fibers were sensitized by a modification of the method of Bhatia et al. (5). Reagents were obtained from Sigma-Aldrich unless otherwise noted. Fibers were placed in a 20 mL/L solution of 3-(mercaptopropyl)-trimethoxysilane in dry toluene for 2 h at room temperature, and then rinsed in toluene, creating a glass surface bearing thiol groups. Thiols were reacted with the heterobifunctional agent, {gamma}-maleimidobutyric acid-N-hydroxysuccinimide ester, 2 mmol/L in reagent alcohol for 1 h. To make E1g fibers, the succinimide ester was reacted for 1 h with 0.05 g/L casein in 20 mmol/L carbonate, pH 9.3. To prepare ERE fibers, 4 mg/L 5'-amino-ERE (nucleotide sequence, 5' GTCCAAAGTCAGGTCACAGTGACCTGATCAAAGTT 3'; Research Genetics) was substituted for the protein. E1g was activated using 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, and then incubated with casein-derivatized fibers for 1 h. After extensive washing, fibers were air-dried and stored under dessicant. For binding assays, fibers were mounted inside capillary tubes having a 1.1-mm inner diameter and 80 µL final volume, and ferrules were applied to the ends to permit sample injection and continuous fluid flow through the reaction cell.

Monoclonal antibody specific for E1g was obtained from Dr. Fortune Kohen (Weizmann Institute, Rehovat, Israel). Fab was prepared by papain digestion followed by purification using protein G to remove unreacted IgG and IgG fragments. hER-{alpha} was prepared as described by Wittliff et al. (6). Proteins were labeled with Cy5 (1,3,3,3',3',1',1'-heptamethyl-indodicarbocyanine sulfonic acid; Amersham) according to manufacturer's instructions. IgG was used at a final concentration of 2 x 10-8 mol/L, and Fab was used at a final concentration of 4 x 10-8 mol/L. The concentration and affinity of hER-{alpha} were estimated by radioligand-binding assay (7), and Cy5-labeled hER-{alpha} was used in fiber optic assays at 5 x 10-10 mol/L. Binding of fluorophore-labeled protein to coated fibers was determined using an evanescent fiber optic fluorometer (Threefold Sensors) (8). To maximize the strength of the evanescent field, the fluorometer directed light from a 637 ± 2 nm laser diode into the fiber optic sensor cartridge at an angle just less than the critical angle. A holographic band-stop filter centered at 637 nm allowed the Stokes-shifted fluorescence emitted from Cy5 at wavelengths longer than 650 nm to pass with high efficiency. Light was detected by a photodiode, and the resulting currents were measured by a lock-in amplifier (model SR810; Stanford Research Systems) and collected on a computer using a program written in Labview (National Instruments).

To determine rate constants for association and dissociation, kinetic data were fitted to a mathematical model derived under the following assumptions: (a) first order reaction kinetics applied; (b) there were no interactions between binding sites; (c) the association rate constant was much larger than the dissociation rate constant kon >> koff; (d) the number of binding sites on the fiber was limiting; and (e) the amount of binder consumed in the reaction was small enough to ignore diffusion.

Under assumption (a), the differential equation describing the binding is:

(1)

where P represents the number of bound labeled species and the over-dot represents its time-rate of change; A represents the concentration of labeled binder in solution; B represents the effective concentration of unbound sites on the fiber; kon is the apparent association constant; and koff is the apparent dissociation constant.

Applying the other assumptions and solving Eq. 1Up gives:

(2)

Off rates are fitted to a first order kinetic model that assumes negligible re-binding:

(3)

Both models were equipped with detrending terms for fitting to data. Data were fitted using the custom curve fitting functionality within DeltaGraph (DeltaPoint). As an alternative to this noncompetitive means to determine Kd, a competitive binding protocol was also used to determine some binding constants for hER-{alpha} to various estrogenic ligands.

Sensor responses were measured by incubating a solution containing the binder in the sensor cartridge for either 12.5 min (Fig. 1 , A and B) or 30 (Fig. 1C ) min and collecting the fluorescent response every 5 s throughout the incubation. For dissociation measurements, incubation was followed by flowing a buffer solution over the sensor for 17.5 min (Fig. 1 , A and B) or 30 (Fig. 1C ) min at 0.5 mL/min and measuring sensor response every 5 s. Nonspecific binding was minimized by including 200 mL/L fetal bovine serum in the buffer. Specificity of hER-{alpha} binding was established by observing the absence of response from a similar preparation of cell lysate from yeast not transfected with the her-{alpha} gene (not shown).



View larger version (26K):
[in this window]
[in a new window]
 
Figure 1. Kinetic association and dissociation curves for IgG, Fab, and hER-{alpha} to E1g immobilized on fiber optic sensors.

Optical fibers were prepared that had immobilized E1g, and nonspecific binding was blocked by including 200 mL/L fetal bovine serum. Panels depict actual photocurrents and residual errors, calculated as the experimental data minus the values calculated by least-squares regression. Dissociation kinetics (arrows) were measured during buffer flow at 0.5 mL/min. (A), incubation with Cy5-labeled anti-E1g IgG; (B), incubation with Fab produced from the IgG used in A; (C), incubation with hER-{alpha}.

Sensorgrams refer to the real-time output of evanescent sensors (9)(10). Sensorgrams for the binding of labeled IgG, Fab, and hER-{alpha} demonstrated monotonic association kinetics; dissociation kinetics were generally monotonic, although the slow dissociation rates made measurements susceptible to noise (Fig. 1Up ). Curve fitting with the above models typically gave correlation coefficients r2 <=0.99, with residual errors also shown in Fig. 1Up . Using this method, the apparent Kd for hER-{alpha} to E1g fibers was 2.5 x 10-9 mol/L. For the antibody to E1g, IgG gave an apparent Kd of 1.6 x 10-8 mol/L, whereas Fab gave 1.1 x 10-8 mol/L.

The apparent dissociation constants determined for hER-{alpha} and estrogen mimics obtained from sensor data via the competitive protocol are consistent with radioligand binding data (11)(12)(13)(14)(15). The Kd values obtained using competition were as follows: estradiol-17ß, 2 x 10-10 mol/L; estrone, 2 x 10-8 mol/L; estriol, 2 x 10-8 mol/L; diethylstilbestrol, 2 x 10-9 mol/L; zearalenone, 2 x 10-8 mol/L; and tamoxifen, 2 x 10-9 mol/L. All first digits of the results obtained for the biosensor are expressed as 2 in these preliminary experiments because the solutions used to determine K{alpha} consisted of concentrations of candidate estrogen mimics that were 2 times various powers of 10. In parallel experiments, fiber optic sensors were used to observe binding of hER-{alpha} to the ERE. Binding data were consistent with the observed agonist or antagonist activity of the aforementioned compounds. Graphs of vs concentration of ligand generally displayed an increase in as concentrations increased. This type of response would be expected if hER possesses multiple ligand-binding sites displaying cooperative behavior as has been reported (14)(16). At low ligand concentrations, the likelihood of receptor binding only one ligand in solution dominates. When such binding occurs, a conformational change producing positive cooperativity would increase the on-rate of the receptor binding to the fiber. As the concentration of ligand in solution increases, it becomes more likely that all receptor binding sites are occupied; therefore, the rate of binding to the fiber would decrease, reflecting a decreased concentration of available receptor. Thus, the data obtained with the fiber optic sensor appear to be consistent with expected results.


Acknowledgments

This work was supported by NIH grants NIEHS 2R44ES007471-02 to J.L.W. and J.L.E. and 5R44AG12322 to J.L.E. J.L.W. is a consultant to IA, Inc. J.G.D. holds equity interest in IA, Inc. We thank Bradford Henderson and Ingrid Picazo for technical assistance.


References

  1. Hirchfield TE, inventor. Fluorescent immunoassay employing optical fiber in a capillary tube. US patent 4,447,546, 1984..
  2. Wise DL, Wingard LB, eds. Biosensors with fiber optics. Clifton, NJ: Humana Press, 1992:370pp..
  3. Shriver-Lake L, Anderson GP, Golden JP, Ligler FS. The effect of tapering the optical fiber on evanescent wave measurements. Anal Lett 1992;25:1183-1199.
  4. Altschuh D, Dubs MC, Weiss E, Zeder-Lutz G, Van Regenmortel MHV. Determination of kinetic constants for the interaction between a monoclonal antibody and peptides using surface plasmon resonance. Biochemistry 1992;31:6298-6304. [Medline] [Order article via Infotrieve]
  5. Bhatia SK, Shriver-Lake LC, Prior KJ, Georger JH, Calvert JM, Bredehorst R, et al. Use of thiol-terminal silanes and heterobifunctional crosslinkers for immobilization of antibodies on silica surfaces. Anal Biochem 1989;178:408-413. [Web of Science][Medline] [Order article via Infotrieve]
  6. Wittliff JL, Wenz LL, Dong J, Nawaz Z, Butt TR. Expression and characterization of an active human estrogen receptor as a ubiquitin fusion protein from Escherichia coli. J Biol Chem 1990;265:22016-22022. [Abstract/Free Full Text]
  7. Wittliff JL. Steroid hormone receptors. Pesce AJ Kaplan LA eds. Methods in clinical chemistry 1987:767-795 CV Mosby St. Louis, MO. .
  8. Erb JL, Downward JG, inventors. Surface treatment and light injection apparatus and method. US patent 5,854,863, 1998..
  9. Karlsson R. Real-time competitive kinetic analysis of interactions between low-molecular-weight ligands in solution and surface-immobilized receptors. Anal Biochem 1994;221:142-151. [Web of Science][Medline] [Order article via Infotrieve]
  10. Morton TA, Myszka DG, Chaiken IM. Interpreting complex binding kinetics from optical biosensors: a comparison of analysis by linearization, the integrated rate equation, and numerical integration. Anal Biochem 1995;227:176-185. [Web of Science][Medline] [Order article via Infotrieve]
  11. VanderKuur JA, Wiese T, Brooks SC. Influence of estrogen structure on nuclear binding and progesterone receptor induction by the receptor complex. Biochemistry 1993;32:7002-7008. [Medline] [Order article via Infotrieve]
  12. Bulger WH, Muccitelli RM, Kupfer D. Studies on the estrogenic activity of chlorodecone (kepone) in the rat: effects on uterine estrogen receptor. Mol Pharmacol 1979;15:515-524. [Abstract/Free Full Text]
  13. Chae K, Gibson MK, Korach KS. Estrogen receptor stereochemistry: ligand binding orientation and influence on biological activity. Mol Pharmacol 1991;40:806-811. [Abstract]
  14. Schwartz JA, Skafar DF. Ligand-mediated modulation of estrogen receptor conformation by estradiol analogs. Biochemistry 1993;32:10109-10115. [Medline] [Order article via Infotrieve]
  15. Sasson S. Equilibrium binding analysis of estrogen agonists and antagonists: relation to the activation of the estrogen receptor. Pathol Biol 1991;39:59-69. [Medline] [Order article via Infotrieve]
  16. Notides AC, Lerner N, Hamilton DE. Positive cooperativity of the estrogen receptor. Proc Natl Acad Sci U S A 1981;78:4926-4930. [Abstract/Free Full Text]




This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Web of Science (4)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Smith, R. H.
Right arrow Articles by Wittliff, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, R. H.
Right arrow Articles by Wittliff, J. L.
Related Collections
Right arrow Oak Ridge Conference
Right arrow Endocrinology and Metabolism
Right arrow Automation and Analytical Techniques


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS