Clinical Chemistry Link to Randox Laboratories Web Site
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 46: 1699-1702, 2000;
This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an electronic Letter to
the Editor about this paper
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abbes, A. P.
Right arrow Articles by Engel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abbes, A. P.
Right arrow Articles by Engel, H.
Related Collections
Right arrow Molecular Diagnostics and Genetics
Right arrow Endocrinology and Metabolism
(Clinical Chemistry. 2000;46:1699-1702.)
© 2000 American Association for Clinical Chemistry, Inc.


Technical Briefs

Identification of Two Distinct Mutations at the Same Nucleotide Position, Concomitantly with a Novel Polymorphism in the Vasopressin-Neurophysin II Gene (AVP-NP II) in Two Dutch Families with Familial Neurohypophyseal Diabetes Insipidus

André P. Abbes1, Bennie Bruggeman1, Erica L.T. van den Akker3, Marco R. de Groot4, Anton A.M. Franken2, Valentijn R. Drexhage5 and Henk Engel1,a

Departments of
1 Clinical Chemistry and
2 Internal Medicine, Isala klinieken, Location Sophia, Dr. C.A. van Heesweg 2, 8025 AB Zwolle, The Netherlands
3 Department of Endocrinology, Sophia Children Hospital, Dr. Molewaterplein 60, 3015 GJ Rotterdam, The Netherlands

4 Department of Internal Medicine, Medisch Spectrum Twente, Dr. Ariënsplein 1, 7500 KA Enschede, The Netherlands

5 Department of Pediatrics, Walcheren Hospital, Koudekerkseweg 88, 4380 DD Vlissingen, The Netherlands
a address correspondence to this author at: Department of Clinical Chemistry, Isala klinieken, Location Sophia, Dr. C.A. van Heesweg 2, 8025 AB Zwolle, The Netherlands; fax 31-38-424-7610, e-mail a.p.abbes{at}isala.nl

Familial neurohypophyseal diabetes insipidus (FNDI) is a rare autosomal dominant inherited disease, characterized by serious polyuria and polydipsia, caused by deficient neurosecretion of the antidiuretic hormone, arginine vasopressin (AVP). Vasopressin is a hormone that affects peripherally and centrally regulated functions such as antidiuresis and blood pressure regulation in peripheral tissues and temperature regulation in the central nervous system (1). The antidiuretic function of AVP controls the serum osmolality by stimulating renal water resorption (1)(2). In patients with FNDI, there is insufficient release of AVP, leading to insufficient stimulation of renal water resorption (1)(3)(4)(5). Often, these patients have a constant feeling of thirst that leads to an excessive water intake to compensate for the high urinary output.

FNDI is currently diagnosed by means of the patient-unfriendly water dehydration test in which the patient is deprived of water intake for a certain period. In the case of vasopressin deficiency, there will be continuing water loss, producing weight loss and hypertonic dehydration (4), which can be dangerous if the patient is not carefully observed during the test.

The onset of FNDI is delayed (early childhood) because of the progressive accumulation of the mutant AVP in the AVP-producing cells. The accumulation of the mutant AVP, as a result of (constant) osmotic stimuli, leads to a slowly progressive degeneration of the AVP-producing cells (2)(6).

The molecular background of FNDI is heterogeneous (2)(3)(5)(7)(8), with 33 mutations in the AVP-NP II gene described (Table 1 ).


View this table:
[in this window]
[in a new window]
 
Table 1. Overview of all published mutations in the AVP-NP II gene (partially adapted from the AVP Human Gene Mutation Database, The Genome Database, and partially from the references).

Vasopressin is synthesized in the magnocellular neurons of the hypothalamus as a preprohormone that consists of a signal peptide, vasopressin, neurophysin, and a glycoprotein (3) (Fig. 1 ). After synthesis, the signal peptide is cleaved off, producing a prohormone. During the transport, the prohormone is further processed, ultimately yielding vasopressin and neurophysin (NP II).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Structural organization of the vasopressin-NP gene (vasopressin gene) and the vasopressin precursor.

Adapted from Richter and Schmale (29).

The prohormone, preprovasopressin, is encoded by the 2.5-kb AVP-NP II gene on chromosome 20 and consists of three exons: exon 1 encodes for a signal peptide, vasopressin, and the NH2-terminal part of NP II; exon 2 encodes for the central part of NP II; and exon 3 encodes for the COOH-terminal part of the NP II and a glycoprotein (3).

Among the 33 described mutations, the majority are substitutions and small deletions in the coding sequence of the signal peptide or NP II. Only two mutations have been described in the nine-amino acid-containing AVP protein (see Table 1Up ).

We identified two novel mutations and a polymorphism of the AVP-NP II gene in two unrelated Dutch families in which FNDI was diagnosed. The mutations and polymorphism were identified by DNA sequencing and confirmed by restriction enzyme analysis. Genomic DNA was isolated from peripheral blood samples.

The three exons were amplified by PCR. The primer sequences were based on a publication of Rauch et al. (8) with slight modifications. We extended the primers with an M13 sequence so that we were able to use only one set of Texas Red-labeled sequence primers for sequencing the exons. We had to design a new reverse primer for exon 2 (AVP2M13BK: GAAACAGCTATGACCATGCAGGCCCGCCCCCGCCGCGC), because this primer did not anneal with the target because of a discrepancy in the published sequence. Furthermore, we identified a polymorphism at the primer site. Therefore, the reverse primer for exon 3 was replaced by primer AVPint3M13BK (GAAACAGCTATGACCATGGTCCCAGATCGCTTCCTCTA). The underlined sequence is the M13 reverse sequence.

For DNA sequencing, the PCR samples of all three exons of some patients from both families and some control subjects were sequenced by primer-dye cycle sequencing.

For restriction enzyme analysis, new exon 3 primers were designed (AVPEX3FW: AGAGCTGCGTGACCGAGCCC and AVPEX3BK: ACAGACGCGAGGCCGTGCAT), flanking the Cys116Gly mutation site to create a PCR fragment that includes a native Sau96I restriction site and from which the fragments after digestion could be separated properly. For the HaeII digestion of the Cys116Arg mutant PCR product, the original primers could be used [primer E (8) and primer AVPintM13BK].

Sequencing of all three exons of the AVP-NP II gene by primer dye cycle sequencing showed no discrepancies in exon 1 and exon 2 when the sequences of the patients of both families were compared with normal controls and the published sequence of the AVP-NP II gene. However, sequencing of exon 3 revealed a heterozygous G-to-T mutation in codon 116 for the patients of the first family. The mutation produces a substitution of a cysteine (TGC) to glycine (GGC) in codon 116 of the AVP-NP II gene. This novel mutation introduced a new recognition site for the restriction enzyme Sau96I in addition to two native Sau96I recognition sites.

In a second family, we identified a heterozygous guanine-to-cytosine mutation in codon 116. The mutation produces a substitution of a cysteine (TGC) to arginine (CGC) in codon 116 of the AVP-NP II gene and creates a new recognition site for the restriction enzyme HaeII, in addition to two native HaeII recognition sites.

Some patients showed a homozygous Cys116Gly mutation pattern. This was unexpected because one parent of both patients carried the heterozygous Cys116Gly mutation, whereas the other parent was unaffected. This phenomenon could be explained by a G->A substitution at nucleotide 2369 in intron 3 of the wild-type allele. Because of this polymorphism at the primer site in combination with the extension of the primer with a M13 sequence, only the mutant allele was amplified, producing a homozygous pattern. This polymorphism was found in both families and the control subjects.

We have tested 105 members of both families. All family members with FNDI (59 of 105) showed the heterozygous mutation after Sau96I or HaeII restriction enzyme digestion, whereas in the DNA of unaffected family members and the control group, the mutation was not detected. No family members were found carrying a homozygous Cys116Gly or Cys116Arg mutation.

Cysteine at codon 116 is involved in disulfide bridge forming (Cys98->Cys116) (1). These disulfide bridges are of importance for the secondary structure of NP II. NP II plays a major role in proper processing and secretion of the hormone (1). The changes in the secondary structure of the mutant protein, caused by the Cys116Gly or Cys116Arg mutation in the AVP-NP II gene, leads to a progressive accumulation of the mutant protein in the endoplasmic reticulum of the neuronal cells. This was studied for the Cys116Gly mutation by Nijenhuis and Burbach, of the Department of Medical Pharmacology, Rudolf Magnus Institute for Neurosciences from the University Medical Center in Utrecht, The Netherlands (unpublished results, personal communication). The accumulation of mutant protein is toxic and leads to slowly progressive neuronal cell loss (4)(6)(9)(10). In this way, the release of AVP, produced from the wild-type allele, is hampered as well, and a deficiency of the normal AVP protein will be manifest. This progressive cell loss could explain the dominant inheritance and the delayed onset of the symptoms, characteristic for patients with FNDI (4)(6)(9)(10).

As far as we know, no polymorphisms in the AVP-NP II gene have been published. This case shows the need for care when PCR results are inconsistent. A polymorphism at the primer site can lead to false homozygous results. On the other hand, mutations can be missed when using a primer with a polymorphism at the primer site.

We synthesized a new primer set for exon 3. With this primer set, no false negatives or false homozygous results were found. Because we have now identified the mutation in the AVP-NP II gene within both families, the PCR test followed by restriction enzyme digestion can be used to test family members without admission to a hospital for the water deprivation test. Additionally, presymptomatic screening can now easily be performed. Once diagnosis of FNDI is confirmed, patients can be treated simply by supplying the AVP with commercially available substituents (ddAVP). Whether presymptomatic supplementation will be beneficial to presymptomatically screened family members has yet to be determined and is currently under discussion.


Acknowledgments

We thank Ton Tjabbes (Isala klinieken, Location Sophia, Department of Internal Medicine, Zwolle, The Netherlands) and Joan van Lookeren Campagne (Isala klinieken, Location Sophia, Department of Pediatrics, Zwolle, The Netherlands) for helpful suggestions and discussion.


References

  1. De Bree FM. Biosynthesis of vasopressin: prohormone targeting and posttranslational modifications [Thesis] 1995 CIP-DATA Royal Library The Hague. .
  2. Ito M, Jameson JL. Molecular basis of autosomal dominant neurohypophyseal diabetes insipidus. Cellular toxicity caused by the accumulation of mutant vasopressin precursors within the endoplasmic reticulum. J Clin Invest 1997;99:1897-1905.[ISI][Medline] [Order article via Infotrieve]
  3. Bichet DG. The posterior pituitary. In: Melmed S, ed. The pituitary. Cambridge, MA: Blackwell Scientific Publications, Inc., 1995:277–306..
  4. Rimoin DL, Phillips JA. Genetic disorders of the pituitary gland. Rimoin DL Connor JM Pyeritz RE eds. Emery and Rimoin’s principles and practices of medical genetics, 3rd ed 1987:1355-1364 Churchill Livingstone New York. .
  5. Repaske DR, Medlej R, Gültekin EK, Krishnamani MRS, Halaby G, Findling JW, Phillips JA. Heterogeneity in clinical manifestation of autosomal dominant neurohypophyseal diabetes insipidus caused by a mutation encoding Ala->Val in the signal peptide of arginine vasopressin/neurophysin II/copeptin precursor. J Clin Endocrinol Metab 1997;82:51-56.[Abstract/Free Full Text]
  6. Nijenhuis M, Zalm R, Burbach JPH. Mutations in the vasopressin prohormone involved in diabetes insipidus impair endoplasmatic reticulum export, but not in sorting. J Biol Chem 1999;274:21200-21208.[Abstract/Free Full Text]
  7. Rittig S, Robertson GL, Siggaard C, Kovács L, Gregersen N, Nyborg J, Pedersen EB. Identification of 13 new mutations in the vasopressin-neurophysin II gene in 17 kindreds with familial autosomal dominant neurohypophyseal diabetes insipidus. Am J Hum Genet 1996;58:107-117.[ISI][Medline] [Order article via Infotrieve]
  8. Rauch F, Lenzner C, Nürnberg P, Frömmel C, Vetter U. A novel mutation in the coding region for neurophysin II is associated with autosomal dominant neurohypophyseal diabetes insipidus. Clin Endocrinol 1996;44:45-51.[Medline] [Order article via Infotrieve]
  9. Meier C. Molecular pathology of familial central diabetes insipidus. Eur J Endocrinol 1996;134:683-686.[ISI][Medline] [Order article via Infotrieve]
  10. Olias G, Richter D, Schmale H. Heterologous expression of human vasopressin neurophysin precursors in a pituitary cell line: defective transport of mutant protein from patients with familial diabetes insipidus. DNA Cell Biol 1996;15:929-935.[ISI][Medline] [Order article via Infotrieve]
  11. Rutishauser J. A novel point mutation in the translation initiation codon of the pre-pro-vasopressin-neurophysin II gene: cosegregation with morphological abnormalities and clinical symptoms in autosomal dominant neurohypophyseal diabetes insipidus. J Clin Endocrinol Metab 1996;81:192-198.[Abstract]
  12. McLeod JF. Familial neurohypophyseal diabetes insipidus associated with a signal peptide mutation. J Clin Endocrinol Metab 1993;77:599A-599G.
  13. Rittig S, Siggaard C, Ozata M, Yetkin L, Gundogan MA, Robertson GL, Pedersen EB. Familial neurohypophyseal diabetes insipidus due to a mutation that substitutes histidine for tyrosine-2 in the antidiuretic hormone. J Investig Med 1996;44:387a.
  14. Willcutts MD, Felner E, White PC. Autosomal recessive familial neurohypophyseal diabetes insipidus with continued secretion of mutant weakly active vasopressin. Hum Mol Genet 1999;8:1303-1307.[Abstract/Free Full Text]
  15. Bahnsen U. A missense mutation in the vasopressin-neurophysin precursor gene cosegregates with human autosomal dominant neurohypophyseal diabetes insipidus. EMBO J 1992;11:19-23.[ISI][Medline] [Order article via Infotrieve]
  16. Goking NQ, Chertow BS, Robertson GL, Rittig S, Siggard C, Pedersen EB. Familial neurohypophyseal diabetes insipidus: a novel mutation presenting with enuresis. J Investig Med 1997;45:29a.
  17. Gagliardi PC. Autosomal dominant neurohypophyseal diabetes insipidus associated with a missense mutation encoding Gly23->Val in neurophysin II. J Clin Endocrinol Metab 1997;82:3643-3646.[Abstract/Free Full Text]
  18. Calvo B, Bilbao JR, Rodriguez A, Rodriguez-Arnao MD, Castano L. Molecular analysis in familial neurohypophyseal diabetes insipidus: early diagnosis of an asymptomatic carrier. J Clin Endocrinol Metab 1999;84:3351-3354.[Abstract/Free Full Text]
  19. Heppner C. Identification of mutations of the arginine-vasopressin-neurophysin II gene in two kindreds with familial central diabetes insipidus. J Clin Endocrinol Metab 1998;83:693-696.[Abstract/Free Full Text]
  20. Repaske DR. A de novo mutation in the coding sequence for neurophysin II (Pro24->Leu) is associated with onset and transmission of autosomal dominant neurohypophyseal diabetes insipidus. J Clin Endocrinol Metab 1994;79:421-427.[Abstract]
  21. Yuasa H. Glu-47, which forms a salt bridge between neurophysin-II and arginine vasopressin, is detected in patients with familial central diabetes insipidus. J Clin Endocrinol Metab 1993;77:600-604.[Abstract]
  22. Grant FD. Two novel mutations of the vasopressin gene associated with familial diabetes insipidus and identification of an asymptomatic carrier infant. J Clin Endocrinol Metab 1998;83:3958-3964.[Abstract/Free Full Text]
  23. Ito M. A single base substitution in the coding region for neurophysin II associated with familial central diabetes insipidus. J Clin Invest 1991;87:725-728.
  24. Nagasaki H. Two novel mutations in the coding region for neurophysin II associated with familial central diabetes insipidus. J Clin Endocrinol Metab 1995;80:1352-1356.[Abstract]
  25. Ueta Y. A new type of familial central diabetes insipidus caused by a single base substitution in the neurophysin II coding region of the vasopressin gene. J Clin Endocrinol Metab 1996;81:1787-1790.[Abstract]
  26. Rutishauser J, Kopp P, Gaskill MB, Kotlar TJ, Robertson GL. A novel mutation (R97C) in the neurophysin moiety of prepro-vasopressin-neurophysin II associated with autosomal-dominant neurohypophyseal diabetes insipidus. Mol Genet Metab 1999;67:89-92.[ISI][Medline] [Order article via Infotrieve]
  27. Mundschenk J, Rittig S, Hensen J, Lehnert H. A novel mutation in a coding region of the arginine vasopressin-neurophysin II gene in a family with autosomal dominant neurohypophyseal diabetes insipidus. Exp Clin Endocrinol Diabetes 1998;106:81a.
  28. Calvo B. Identification of a novel nonsense mutation and a missense substitution in the vasopressin-neurophysin II gene in two Spanish kindreds with familial neurohypophyseal diabetes insipidus. J Clin Endocrinol Metab 1998;83:995-997.[Abstract/Free Full Text]
  29. Richter D, Schmale H. Molecular aspects of the expression of the vasopressin gene. In: Czernichow P, Robinson AG, eds. Frontiers of hormone research, Vol. 13. Diabetes insipidus in man. Basel: S. Karger, 1985;37–41..



The following articles in journals at HighWire Press have cited this article:


Home page
J. Clin. Endocrinol. Metab.Home page
S. Rittig, C. Siggaard, M. Ozata, I. Yetkin, N. Gregersen, E. B. Pedersen, and G. L. Robertson
Autosomal Dominant Neurohypophyseal Diabetes Insipidus due to Substitution of Histidine for Tyrosine2 in the Vasopressin Moiety of the Hormone Precursor
J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3351 - 3355.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Nijenhuis, E. L. T. van den Akker, R. Zalm, A. A. M. Franken, A. P. Abbes, H. Engel, D. de Wied, and J. P. H. Burbach
Familial Neurohypophysial Diabetes Insipidus in a Large Dutch Kindred: Effect of the Onset of Diabetes on Growth in Children and Cell Biological Defects of the Mutant Vasopressin Prohormone
J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3410 - 3420.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Submit an electronic Letter to
the Editor about this paper
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Abbes, A. P.
Right arrow Articles by Engel, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Abbes, A. P.
Right arrow Articles by Engel, H.
Related Collections
Right arrow Molecular Diagnostics and Genetics
Right arrow Endocrinology and Metabolism


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS