|
|
||||||||
Technical Briefs |
Departments of
1
Clinical Chemistry and
2
Internal Medicine, Isala klinieken, Location Sophia, Dr. C.A. van Heesweg 2, 8025 AB Zwolle, The Netherlands
3
Department of Endocrinology, Sophia Children Hospital, Dr. Molewaterplein 60, 3015 GJ Rotterdam, The Netherlands
4
Department of Internal Medicine, Medisch Spectrum Twente, Dr. Ariënsplein 1, 7500 KA Enschede, The Netherlands
5
Department of Pediatrics, Walcheren Hospital, Koudekerkseweg 88, 4380 DD Vlissingen, The Netherlands
a address
correspondence to this author at: Department of Clinical Chemistry, Isala klinieken, Location Sophia, Dr. C.A. van Heesweg 2, 8025 AB Zwolle, The Netherlands; fax 31-38-424-7610, e-mail a.p.abbes{at}isala.nl
Familial neurohypophyseal diabetes insipidus (FNDI) is a rare autosomal dominant inherited disease, characterized by serious polyuria and polydipsia, caused by deficient neurosecretion of the antidiuretic hormone, arginine vasopressin (AVP). Vasopressin is a hormone that affects peripherally and centrally regulated functions such as antidiuresis and blood pressure regulation in peripheral tissues and temperature regulation in the central nervous system (1). The antidiuretic function of AVP controls the serum osmolality by stimulating renal water resorption (1)(2). In patients with FNDI, there is insufficient release of AVP, leading to insufficient stimulation of renal water resorption (1)(3)(4)(5). Often, these patients have a constant feeling of thirst that leads to an excessive water intake to compensate for the high urinary output.
FNDI is currently diagnosed by means of the patient-unfriendly water dehydration test in which the patient is deprived of water intake for a certain period. In the case of vasopressin deficiency, there will be continuing water loss, producing weight loss and hypertonic dehydration (4), which can be dangerous if the patient is not carefully observed during the test.
The onset of FNDI is delayed (early childhood) because of the progressive accumulation of the mutant AVP in the AVP-producing cells. The accumulation of the mutant AVP, as a result of (constant) osmotic stimuli, leads to a slowly progressive degeneration of the AVP-producing cells (2)(6).
The molecular background of FNDI is heterogeneous (2)(3)(5)(7)(8), with 33 mutations in the AVP-NP II gene
described (Table 1
).
|
Vasopressin is synthesized in the magnocellular neurons of the
hypothalamus as a preprohormone that consists of a signal peptide,
vasopressin, neurophysin, and a glycoprotein (3) (Fig. 1
). After synthesis, the signal peptide is cleaved off, producing
a prohormone. During the transport, the prohormone is further
processed, ultimately yielding vasopressin and neurophysin (NP II).
|
The prohormone, preprovasopressin, is encoded by the 2.5-kb AVP-NP II gene on chromosome 20 and consists of three exons: exon 1 encodes for a signal peptide, vasopressin, and the NH2-terminal part of NP II; exon 2 encodes for the central part of NP II; and exon 3 encodes for the COOH-terminal part of the NP II and a glycoprotein (3).
Among the 33 described mutations, the majority are substitutions and
small deletions in the coding sequence of the signal peptide or NP II.
Only two mutations have been described in the nine-amino
acid-containing AVP protein (see Table 1
).
We identified two novel mutations and a polymorphism of the AVP-NP II gene in two unrelated Dutch families in which FNDI was diagnosed. The mutations and polymorphism were identified by DNA sequencing and confirmed by restriction enzyme analysis. Genomic DNA was isolated from peripheral blood samples.
The three exons were amplified by PCR. The primer sequences were based on a publication of Rauch et al. (8) with slight modifications. We extended the primers with an M13 sequence so that we were able to use only one set of Texas Red-labeled sequence primers for sequencing the exons. We had to design a new reverse primer for exon 2 (AVP2M13BK: GAAACAGCTATGACCATGCAGGCCCGCCCCCGCCGCGC), because this primer did not anneal with the target because of a discrepancy in the published sequence. Furthermore, we identified a polymorphism at the primer site. Therefore, the reverse primer for exon 3 was replaced by primer AVPint3M13BK (GAAACAGCTATGACCATGGTCCCAGATCGCTTCCTCTA). The underlined sequence is the M13 reverse sequence.
For DNA sequencing, the PCR samples of all three exons of some patients from both families and some control subjects were sequenced by primer-dye cycle sequencing.
For restriction enzyme analysis, new exon 3 primers were designed (AVPEX3FW: AGAGCTGCGTGACCGAGCCC and AVPEX3BK: ACAGACGCGAGGCCGTGCAT), flanking the Cys116Gly mutation site to create a PCR fragment that includes a native Sau96I restriction site and from which the fragments after digestion could be separated properly. For the HaeII digestion of the Cys116Arg mutant PCR product, the original primers could be used [primer E (8) and primer AVPintM13BK].
Sequencing of all three exons of the AVP-NP II gene by primer dye cycle sequencing showed no discrepancies in exon 1 and exon 2 when the sequences of the patients of both families were compared with normal controls and the published sequence of the AVP-NP II gene. However, sequencing of exon 3 revealed a heterozygous G-to-T mutation in codon 116 for the patients of the first family. The mutation produces a substitution of a cysteine (TGC) to glycine (GGC) in codon 116 of the AVP-NP II gene. This novel mutation introduced a new recognition site for the restriction enzyme Sau96I in addition to two native Sau96I recognition sites.
In a second family, we identified a heterozygous guanine-to-cytosine mutation in codon 116. The mutation produces a substitution of a cysteine (TGC) to arginine (CGC) in codon 116 of the AVP-NP II gene and creates a new recognition site for the restriction enzyme HaeII, in addition to two native HaeII recognition sites.
Some patients showed a homozygous Cys116Gly mutation pattern. This was
unexpected because one parent of both patients carried the heterozygous
Cys116Gly mutation, whereas the other parent was unaffected. This
phenomenon could be explained by a G
A substitution at nucleotide
2369 in intron 3 of the wild-type allele. Because of this polymorphism
at the primer site in combination with the extension of the primer with
a M13 sequence, only the mutant allele was amplified, producing a
homozygous pattern. This polymorphism was found in both families and
the control subjects.
We have tested 105 members of both families. All family members with FNDI (59 of 105) showed the heterozygous mutation after Sau96I or HaeII restriction enzyme digestion, whereas in the DNA of unaffected family members and the control group, the mutation was not detected. No family members were found carrying a homozygous Cys116Gly or Cys116Arg mutation.
Cysteine at codon 116 is involved in disulfide bridge forming
(Cys98
Cys116) (1). These disulfide bridges are of
importance for the secondary structure of NP II. NP II plays a major
role in proper processing and secretion of the hormone (1).
The changes in the secondary structure of the mutant protein, caused by
the Cys116Gly or Cys116Arg mutation in the AVP-NP II gene,
leads to a progressive accumulation of the mutant protein in the
endoplasmic reticulum of the neuronal cells. This was studied for the
Cys116Gly mutation by Nijenhuis and Burbach, of the Department of
Medical Pharmacology, Rudolf Magnus Institute for Neurosciences from
the University Medical Center in Utrecht, The Netherlands (unpublished
results, personal communication). The accumulation of mutant protein is
toxic and leads to slowly progressive neuronal cell loss (4)(6)(9)(10). In this way, the release of AVP, produced from the wild-type
allele, is hampered as well, and a deficiency of the normal AVP protein
will be manifest. This progressive cell loss could explain the dominant
inheritance and the delayed onset of the symptoms, characteristic for
patients with FNDI (4)(6)(9)(10).
As far as we know, no polymorphisms in the AVP-NP II gene have been published. This case shows the need for care when PCR results are inconsistent. A polymorphism at the primer site can lead to false homozygous results. On the other hand, mutations can be missed when using a primer with a polymorphism at the primer site.
We synthesized a new primer set for exon 3. With this primer set, no false negatives or false homozygous results were found. Because we have now identified the mutation in the AVP-NP II gene within both families, the PCR test followed by restriction enzyme digestion can be used to test family members without admission to a hospital for the water deprivation test. Additionally, presymptomatic screening can now easily be performed. Once diagnosis of FNDI is confirmed, patients can be treated simply by supplying the AVP with commercially available substituents (ddAVP). Whether presymptomatic supplementation will be beneficial to presymptomatically screened family members has yet to be determined and is currently under discussion.
Acknowledgments
We thank Ton Tjabbes (Isala klinieken, Location Sophia, Department of Internal Medicine, Zwolle, The Netherlands) and Joan van Lookeren Campagne (Isala klinieken, Location Sophia, Department of Pediatrics, Zwolle, The Netherlands) for helpful suggestions and discussion.
References
Val in the signal peptide of arginine vasopressin/neurophysin II/copeptin precursor. J Clin Endocrinol Metab 1997;82:51-56.
Val in neurophysin II. J Clin Endocrinol Metab 1997;82:3643-3646.
Leu) is associated with onset and transmission of autosomal dominant neurohypophyseal diabetes insipidus. J Clin Endocrinol Metab 1994;79:421-427.[Abstract]
The following articles in journals at HighWire Press have cited this article:
![]() |
S. Rittig, C. Siggaard, M. Ozata, I. Yetkin, N. Gregersen, E. B. Pedersen, and G. L. Robertson Autosomal Dominant Neurohypophyseal Diabetes Insipidus due to Substitution of Histidine for Tyrosine2 in the Vasopressin Moiety of the Hormone Precursor J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3351 - 3355. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nijenhuis, E. L. T. van den Akker, R. Zalm, A. A. M. Franken, A. P. Abbes, H. Engel, D. de Wied, and J. P. H. Burbach Familial Neurohypophysial Diabetes Insipidus in a Large Dutch Kindred: Effect of the Onset of Diabetes on Growth in Children and Cell Biological Defects of the Mutant Vasopressin Prohormone J. Clin. Endocrinol. Metab., July 1, 2001; 86(7): 3410 - 3420. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |