Clinical Chemistry Siemens Point of Care - Urinalysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 47: 1939-1944, 2001;
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruiz, A.
Right arrow Articles by Borrego, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruiz, A.
Right arrow Articles by Borrego, S.
Related Collections
Right arrow Molecular Diagnostics and Genetics
(Clinical Chemistry. 2001;47:1939-1944.)
© 2001 American Association for Clinical Chemistry, Inc.


Articles

Novel Technique for Scanning of Codon 634 of the RET Protooncogene with Fluorescence Resonance Energy Transfer and Real-Time PCR in Patients with Medullary Thyroid Carcinoma

Agustín Ruiz, Guillermo Antiñolo, Irene Marcos and Salud Borregoa

Unidad de Genética Médica y Diagnóstico Prenatal Hospitales Universitarios Virgen del Rocío, 41013-Seville, Spain.

aAddress correspondence to this author at: Unidad de Genética Médica y Diagnóstico Prenatal, Hospitales Universitarios Virgen del Rocío, Avda. Manuel Siurot s/n, 41013-Seville, Spain. Fax 34-955-01-3473; e-mail sborrego{at}hvr sas.cica.es


   Abstract
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Background: The multiple endocrine neoplasia 2 (MEN 2) syndromes [MEN 2A, MEN 2B, and familial medullary thyroid carcinoma (FMTC)] are caused by germline mutations of the RET protooncogene. Because 85% of MEN 2A patients and 30% of FMTC patients have mutations at codon 634, the recommended molecular analyses begin at exon 11, where codon 634 is located.

Methods: We scanned codon 634 of the RET protooncogene with real-time PCR and fluorescence resonance energy transfer (FRET), using a unique pair of internal probes to detect mutations localized at codon 634. We compared results with sequencing results in 66 patients.

Results: The method detected all codon 634 mutations available in our laboratory (Cys634Tyr, Cys634Arg, Cys634Phe, Cys634Trp). Comparing this method with the direct sequencing of exon 11 in a cohort of 66 patients with MTC, the system identified all 14 MTC patients carrying germline mutations at codon 634. One apparent false-positive result occurred among 52 patients.

Conclusions: The simultaneous scanning of multiple mutations is possible with the FRET system. The method allows rapid characterization of germline mutations at codon 634 in MTC patients.


   Introduction
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Medullary thyroid carcinoma (MTC) 1 represents ~5–10% of malignant thyroid tumors. Approximately 75% of all MTC cases are sporadic, and 25% are grouped in a hereditary cancer syndrome known as multiple endocrine neoplasia 2 (MEN 2). MEN 2 is an autosomal dominant that is associated with mutations in the RET protooncogene. MEN 2 includes MEN 2A and 2B, and familial MTC (FMTC). Inter- and intrafamilial variation is seen in the age of presentation and the incidence of pheochromocytoma and hyperparathyroidism. Classically, it was thought that the penetrance was 70% at the age of 70 (1).

The RET protooncogene, localized in 10q11.2, encodes a receptor with tyrosine-kinase activity (2)(3)(4). The genomic structure of RET contains 21 exons distributed throughout 60 kilobases (5).

Data collected by the International RET Mutation Consortium (6) indicate that in 92% of MEN 2 cases, germline mutations are found in six exons of the RET gene: 10, 11, 13, 14, 15, and 16. In MEN 2A, the most common form of MEN 2, 98% of patients have germline mutations involving five cysteine codons partially encoding the extracellular domain of the protein (codons 609, 611, 618, 620, and 634). Furthermore, in MEN 2A, 85% of the families have a mutation at codon 634 (6)(7)(8). In classic FMTC, 88% of the cases carry a germline mutation in RET, 30% of the cases of FMTC having a mutation at codon 634 (6). Therefore, the highest frequency of mutations associated with familial cases of MTC appears at codon 634. The rest of the mutations associated with MEN 2A and FMTC are found distributed at the other four cysteine codons mentioned above (609, 611, 618, and 620, exon 10). Subsequently, other mutations localized at other cysteine codons (630 and 631) and noncysteinic codons of the intracellular tyrosine-kinase domain of the RET protein have been reported (codons 768, 790, 791, 804, and 891) (1).

Increasing knowledge in recent years about the molecular basis of MEN 2 syndromes has been translated into clinical practice (9). The results of genetic analyses produce dramatic alterations of the course of the disease because at-risk individuals positive for a mutation associated with MEN 2 can undergo prophylactic thyroidectomy, which is believed to be life-saving. At present, no single-step method exists to carry out a molecular analysis of the hotspots related to MEN 2A and FMTC that can be applied to routine diagnosis. In most clinical laboratories, the direct sequencing of exons containing hotspots of the RET protooncogene is routinely performed in all MTC patients (except for cases in which MEN 2B is suspected, where a direct analysis of the M918T mutation is the first step of the molecular evaluation). This approach, although highly sensitive, is tedious, expensive, and awkward when dealing with large numbers of MTC cases. In this report, we present the use of real-time PCR and fluorescence resonance energy transfer (FRET) (10) to simultaneously screen the alterations of codon 634 of the RET protooncogene in a cohort of 66 MTC patients.


   Materials and Methods
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
patients
Patients (n = 66) diagnosed with and treated for MTC between 1994 and 2000 in Andalucia (southern Spain) were included in this study. Informed consent was obtained from all. In all cases, we performed a systematic search for mutations using semiautomatic sequencing of exons 10, 11, 13, 14, 15, and 16 of the RET protooncogene as routine scanning of molecular alterations related to the familial forms of MTC, following the protocols reported previously (7)(8).

dna extraction
We obtained 15 mL of peripheral blood from all patients to isolate germline DNA from leukocytes. DNA extraction was performed according to standard protocols, as described elsewhere (11). For the DNA, we measured absorbances at 260 and 280 nm to estimate the concentration. We prepared aliquots of DNA at a concentration of 25 ng/µL. The rest of the stock was cryopreserved at -80 °C.

primers
We selected amplification primers for the PCR of exon 11 of the RET protooncogene using the PRIME command of the Wisconsin GCG package (Genetics Computer Group, Inc.), following the manufacturer’s instructions. The DNA sequence used to carry out this study corresponds to the partial genomic sequence of the 3' end of the RET protooncogene (GenBank no. AJ243297). The selected pair of primers amplified a segment of 448 bp, corresponding to positions 14782–14800 (forward primer, taggagggggcagtaaatg) and 15210–15227 (reverse primer, ggatcttgaaggcatccac) according to GenBank file AJ243297 (Fig. 1 ). The RETex11 anchor probe (aagcctcacaccacccccacccacagat) was 3' labeled with fluorescein, and RETex11 sensor (actgtgcgacgagctgtgccgc) was 5' labeled with LC-Red640 dye and 3' phosphorylated as indicated (Fig. 1 ).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of the FRET system designed to test codon 634 of the RET protooncogene.

The scanned region is covered by the sensor probe (RETex11 Sensor). Underlined sequences represent the amplification primers.

pcr conditions
PCR was performed in the LightCycler® system (Roche). PCR was performed to amplify the segment of the RET protooncogene that flanks codon 634 (Fig. 1Up ) at a final volume of 10 µL using 25 ng of genomic DNA, 1 µM each amplification primer, 4.4 mM MgCl2, 0.2 µM each detection probe (RETex11 anchor and sensor probes; Fig. 1Up ), and 1 µL of LC Master Hybridization Probes Mix (Roche). We used an initial denaturation step of 95 °C for 2 min followed by 55 cycles of 95 °C for 0 s, 66 °C for 15 s, and 72 °C for 15 s. To check the specificity of the PCR products obtained, a conventional electrophoresis of amplified samples was routinely performed (Fig. 2 ).



View larger version (64K):
[in this window]
[in a new window]
 
Figure 2. Melting experiment of amplicons (A), monitoring of DNA amplification in real-time using FRET probes (B), and conventional electrophoresis (C).

(A), melting experiment of amplicons obtained with primers designed to amplify the genomic DNA region containing exon 11 of the RET protooncogene and SYBR Green I fluorochrome. A unique DNA species with a Tm of 93 °C was observed. (B), homogeneous and exponential increases of fluorescence can be observed in cycle 32 in DNA samples. (C), conventional electrophoresis of the PCR products obtained during the amplification in the LightCycler. A unique 442-bp band can be observed in each PCR reaction.

positive controls
We molecularly characterized a group of four independent controls by sequencing and rechecking with PCR restriction fragment-length polymorphism analysis. The positive heterozygote controls corresponded to four mutations that affect codon 634 of the RET protooncogene in MTC patients (Cys634Tyr, Cys634Arg, Cys634Phe, Cys634Trp).

fret melting curves
The probes (Fig. 1Up ) were purchased from TIB MOLBIOL (Berlin). The final conditions to obtain the specific melting curve were 95 °C for 20 s, 72 °C for 25 s, 70 °C for 25 s, 50 °C for 0 s, and 95 °C for 0 s [with a temperature-transfer speed of 0.5 °C/s in each step, except the first step (20 °C/s) and the last step, in which the speed of temperature transfer was 0.4 °C/s]. In the last step, a continuous fluorometric register was performed (F2/F1), fixing the gains of the system at 1, 30, and 30 on channels F1, F2, and F3, respectively.


   Results
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
Specific amplification of the DNA sequences corresponding to the sequences of the internal probes was indicated by an increase of fluorescence in channel F2 (corresponding to the emission of fluorochrome RED640, which is activated during the FRET process; Fig. 2Up ) in the LightCycler system. Specific amplification was monitored in this manner for all samples tested. In addition, when we checked the PCR product using SYBR® Green I fluorochrome and melting analysis in the LightCycler system, a unique DNA species melting at 93 °C could be observed (Fig. 2Up ).

We performed mutation scanning for specific mutations at codon 634 of the RET protooncogene using fluorescence monitoring during the melting experiment. This process consisted of a temperature ramp coupled to a continuous fluorometric register. With the short-cooling melting procedure (95 °C for 0 s, 50 °C for 0 s, 95 °C for 0 s with a temperature-transfer speed of 0.4 °C/s in the last step), the results of the FRET experiment suggested that the probes do not hybridize well under these conditions. Therefore, we designed a new melting experiment in which several conditions were modified and new incubation steps were included for the anchor and sensor probes at the theoretical annealing temperature (see Materials and Methods for details). Fluorescence melting peak analysis revealed a high melting transition with a melting temperature (Tm) at 75 °C, corresponding to the wild-type sequence.

To determine whether FRET can detect codon 634 mutations, we genotyped individuals known to carry codon 634 mutations (Cys->Arg, Cys->Phe, Cys->Tyr, and Cys->Trp). Our results show that the system designed detects all of the mutations in the sequence mentioned above, with specific Tms for each variant (Fig. 3 ). These results seem to show that the FRET system could be used to scan the Cys634 mutation hotspot without the need to design a specific probe for each mutation.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. Tms of four different mutations at codon 634 of the RET protooncogene.

Each DNA mutation has an specific melting point using the probe design reported in this work: Cys634Arg, 72 °C; Cys634Tyr, 70.3 °C; Cys634Phe, 68.8 °C; and Cys634Trp, 67.8 °C. The minimum shift of Tm between the wild-type allele and any mutation (Cys634Arg) is 2.5 °C.

To evaluate our method against the gold-standard mutation-detection technique of direct sequencing, we blindly tested a cohort of 66 MTC patients who had been studied previously in our laboratory with direct sequencing of PCR products of exon 11 of the RET protooncogene. Our method took ~120 min to reliably analyze codon 634 of the RET protooncogene in all 66 samples. Among these 66, 14 (21%) were known to be mutation positive at codon 634, and FRET detected all 14 mutations. Only 1 false positive (1 of 52 known mutation negative cases) was detected during the study. We believe that the false positive was caused by low yields of PCR product during amplification, a problem that can be avoided by double checking all samples in each study. FRET analysis has only two steps, DNA extraction and real-time PCR, whereas sequencing protocols involve a multistep and time-consuming processing of the samples.


   Discussion
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 
With the increasing demand for genetic testing (12), real-time PCR in combination with FRET has been used to genotype various gene mutations (13)(14)(15)(16)(17)(18)(19). The technology can simultaneously scan the spectrum of point mutations occurring in codons 12, 13, and 61 of Nras, using a combination of fluorescence melting curve analyis and multicolor fluorometry (20). It has not, however, been used to simultaneously scan multiple mutations at a mutational hotspot, despite its versatility (13)(21).

We designed a multistep melting experiment to resolve the codon 634 mutations of the protooncogene RET. To favor the hybridization of the probes, we included new incubation steps for the anchor and sensor probes at the theoretical annealing temperatures (72 °C and 70 °C, respectively). A slow ramp speed during the annealing phase and new annealing steps during the melting process can enhance the signal intensity compared with one-step annealing (20)(22).

Our system detects the four codon 634 mutations available in our laboratory. The differences in Tm between the wild-type allele and mutant alleles correlate with the mismatch stability (G:T Arg and Tyr, G:A Phe, and C:C Trp). A shorter detection probe may facilitate discrimination between the Arg634 and Cys634 alleles (less destabilizing mismatch) (23).

Our system differs greatly from the template-directed dye-terminator incorporation method that has been successfully applied for the detection of RET hotspot mutations (24). In template-directed dye-terminator incorporation, each mutation is detected by a specific primer and the PCR products must be processed (24)(25). In contrast, the method described here uses only one pair of probes that detects all possible changes in the positions in which the sensor probe hybridizes (Fig. 1Up ), and no post-PCR processing is needed because the melting is coupled to the PCR program.

Because RET testing is part of the standard of care in MEN 2, many clinical laboratories use the perceived gold standard of sequencing (1). In general, sequencing is labor-intensive and expensive, even in the semiautomated setting (26). We believe that our method could be used as an initial screen of the RET codon 634 hotspot. However, given that this technique is relatively new, we would still recommend that when a variant is detected, reanalysis of the sample, either with specific digestion (PCR-restriction fragment length polymorphism analysis) or with direct sequencing, should be performed before a clinical result is issued. We suspect that given further experience with this technique, the secondary confirmation may no longer be necessary.

If no alteration is detected during the melting experiment, it may be possible to issue a negative result for this hotspot without additional molecular tests. Because 75% of MTC cases are sporadic, this would reduce both response time and labor. We cannot demonstrate that FRET detects every mutation at codon 634 because we did not test all possible mutations. However, taking into account the performance on our known mutation set, as well as our study of 66 consecutive MTC cases, we feel that FRET will detect all variants.

In conclusion, our study suggests that the combined use of FRET and real-time PCR is feasible as a scanning method for small regions of DNA. Our pilot study has shown the successful application of FRET to a hotspot for mutations in RET. The approach can likely be adopted for other disease hotspot sites in other genes.


   Acknowledgments
 
We are deeply grateful to the MTC patients and their families for participation in this study. We are very grateful to Charis Eng, who provided invaluable help and comments on the manuscript. We also thank TIB MOLBIOL for their help. Matilde Romero provided technical assistance. This study was partially funded by the Fondo de Investigación Sanitaria (FIS 01/0551) and Consejería de Salud/Comunidad Autónoma de Andalucía (CAA 47/99 and CAA 116/00), Spain. I.M. is the recipient of a fellowship from the Instituto de Salud Carlos III (Grant 99/4250; Ministerio de Sanidad y Consumo, Spain).


   Footnotes
 
1 Nonstandard abbreviations: MEN 2, multiple endocrine neoplasia 2; MTC, medullary thyroid carcinoma; FMTC, familial MTC; FRET, fluorescence resonance energy transfer; and Tm, melting temperature.


   References
Top
Abstract
Introduction
Materials and Methods
Results
Discussion
References
 

  1. Eng C. RET proto-oncogene in the development of human cancer [Review]. J Clin Oncol 1999;17:380-393.[Abstract/Free Full Text]
  2. Gardner E, Papi L, Easton DF, Cummings T, Jackson CE, Kaplan M, et al. Genetic linkage studies map the multiple endocrine neoplasia type 2 loci to a small interval on chromosome 10q11.2. Hum Mol Genet 1993;2:241-246.[Abstract/Free Full Text]
  3. Mulligan LM, Kwok JB, Healey CS, Elsdon MJ, Eng C, Gardner E, et al. Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature 1993;363:458-460.[Medline] [Order article via Infotrieve]
  4. Donis-Keller H, Dou S, Chi D, Carlson KM, Toshima K, Lairmore TC, et al. Mutations in the RET proto-oncogene are associated with MEN 2A and FMTC. Hum Mol Genet 1993;2:851-856.[Abstract/Free Full Text]
  5. Myers SM, Eng C, Ponder BA, Mulligan LM. Characterization of RET proto-oncogene 3' splicing variants and polyadenylation sites: a novel C-terminus for RET. Oncogene 1995;11:2039-2045.[Web of Science][Medline] [Order article via Infotrieve]
  6. Eng C, Clayton D, Schuffenecker I, Lenoir G, Cote G, Gagel RF, et al. The relationship between specific RET proto-oncogene mutations and disease phenotype in multiple endocrine neoplasia type 2. International RET mutation consortium analysis. JAMA 1996;276:1575-1579.[Abstract/Free Full Text]
  7. Sanchez B, Antiñolo G, Navarro E, Japon MA, Conde AF, Astorga R, Borrego S. Cys634 mutations in the RET proto-oncogene in Spanish families affected by MEN 2A. Hum Mutat 1998;S1:S72-S73.
  8. Sanchez B, Robledo M, Biarnes J, Saez ME, Volpini V, Benitez J, et al. High prevalence of the C634Y mutation in the RET proto-oncogene in MEN 2A families in Spain. J Med Genet 1999;36:68-70.[Abstract/Free Full Text]
  9. Eng C. Seminars in medicine of the Beth Israel Hospital, Boston. The RET proto-oncogene in multiple endocrine neoplasia type 2 and Hirschsprung’s disease [Review]. N Engl J Med 1996;335:943-951.[Free Full Text]
  10. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 1997;22:130-131.[Web of Science][Medline] [Order article via Infotrieve]
  11. Dracapoly NH Haines JL Korf BR Moir CG Seidman LE Seidman JGet al eds. Current protocols in human genetics 1994:A.3B1-2 John Wiley & Sons New York. .
  12. Ravine D. Automated mutation analysis [Review]. J Inherit Metab Dis 1999;22:503-518.[Web of Science][Medline] [Order article via Infotrieve]
  13. Bernard PS, Ajioka RS, Kushner JP, Wittwer CT. Homogeneous multiplex genotyping of hemochromatosis mutations with fluorescent hybridization probes. Am J Pathol 1998;153:1055-1061.[Abstract/Free Full Text]
  14. von Ahsen N, Schutz E, Armstrong VW, Oellerich M. Rapid detection of prothrombotic mutations of prothrombin (G20210A), factor V (G1691A), and methylenetetrahydrofolate reductase (C677T) by real-time fluorescence PCR with the LightCycler. Clin Chem 1999;45:694-696.[Free Full Text]
  15. von Ahsen N, Oellerich M, Schutz E. Use of two reporter dyes without interference in a single-tube rapid-cycle PCR: {alpha}1-antitrypsin genotyping by multiplex real-time fluorescence PCR with the LightCycler. Clin Chem 2000;46:156-161.[Abstract/Free Full Text]
  16. Nauck M, Wieland H, Marz W. Rapid, homogeneous genotyping of the 4G/5G polymorphism in the promoter region of the PAII gene by fluorescence resonance energy transfer and probe melting curves. Clin Chem 1999;45:1141-1147.[Abstract/Free Full Text]
  17. Aslanidis C, Nauck M, Schmitz G. High-speed detection of the two common {alpha}1-antitrypsin deficiency alleles Pi*Z and Pi*S by real-time fluorescence PCR and melting curves. Clin Chem 1999;45:1872-1875.[Free Full Text]
  18. Aslanidis C, Nauck M, Schmitz G. High-speed prothrombin G->A 20210 and methylenetetrahydrofolate reductase C->T 677 mutation detection using real-time fluorescence PCR and melting curves. Biotechniques 1999;27:234-238.[Web of Science][Medline] [Order article via Infotrieve]
  19. Ruiz A, Royo JL, Rubio A, Borrego S, Leal M, Sanchez B, et al. Spectrofluormetric analysis of CCR5-{Delta}32 allele using real-time PCR: prevalence in Southern Spain HIV+ patients and non-infected population [Letter]. AIDS Res Hum Retroviruses 2001;17:191-193.[Web of Science][Medline] [Order article via Infotrieve]
  20. Elenitoba-Johnson KSJ, Bohling SD, Wittwer CT, King TC. Multiplex PCR by multicolor fluorimetry and fluorescence melting curve analysis. Nat Med 2001;7:249-253.[Web of Science][Medline] [Order article via Infotrieve]
  21. Gundry CN, Bernard PS, Herrmann MG, Reed GH, Wittwer CT. Rapid F508del, F508C assay using fluorescent hybridization probes. Genet Test 1999;3:365-370.[Web of Science][Medline] [Order article via Infotrieve]
  22. Bernard PS, Pritham GH, Wittwer CT. Color multiplexing hybridization probes using the apolipoprotein E locus as a model system for genotyping. Anal Biochem 1999;273:221-228.[Web of Science][Medline] [Order article via Infotrieve]
  23. Meuer S Wittwer C Nakagawa K eds. Rapid cycle real-time PCR. Methods and applications 2001:11-19 Springer Berlin. .
  24. Chen X, Zehnbauer B, Gnirke A, Kwok PY. Fluorescence energy transfer detection as a homogeneous DNA diagnostic method. Proc Natl Acad Sci U S A 1997;94:10756-10761.[Abstract/Free Full Text]
  25. Chen X, Kwok PY. Template-directed dye-terminator incorporation (TDI) assay: a homogeneous DNA diagnostic method based on fluorescence resonance energy transfer. Nucleic Acids Res 1997;25:347-353.[Abstract/Free Full Text]
  26. Eng C, Vijg J. Genetic testing: the problems and the promise [Review]. Nat Biotechnol 1997;15:422-426.[Web of Science][Medline] [Order article via Infotrieve]



The following articles in journals at HighWire Press have cited this article:


Home page
J. Mol. Diagn.Home page
R. L. Margraf, R. Mao, W. E. Highsmith, L. M. Holtegaard, and C. T. Wittwer
RET Proto-Oncogene Genotyping Using Unlabeled Probes, the Masking Technique, and Amplicon High-Resolution Melting Analysis
J. Mol. Diagn., April 1, 2007; 9(2): 184 - 196.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
R. L. Margraf, R. Mao, W. E. Highsmith, L. M. Holtegaard, and C. T. Wittwer
Mutation Scanning of the RET Protooncogene Using High-Resolution Melting Analysis
Clin. Chem., January 1, 2006; 52(1): 138 - 141.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S Borrego, R M Fernandez, H Dziema, A Niess, M Lopez-Alonso, G Antinolo, and C Eng
Investigation of germline GFRA4 mutations and evaluation of the involvement of GFRA1, GFRA2, GFRA3, and GFRA4 sequence variants in Hirschsprung disease
J. Med. Genet., March 1, 2003; 40(3): e18 - 18.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
A. Gonzalez, E. Abril, A. Roca, M. J. Aragon, M. J. Figueroa, P. Velarde, J. L. Royo, L. M. Real, and A. Ruiz
CAPN10 Alleles Are Associated with Polycystic Ovary Syndrome
J. Clin. Endocrinol. Metab., August 1, 2002; 87(8): 3971 - 3976.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruiz, A.
Right arrow Articles by Borrego, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruiz, A.
Right arrow Articles by Borrego, S.
Related Collections
Right arrow Molecular Diagnostics and Genetics


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS