| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Articles |
1
Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA 94305;
2
Department of Veterans Affairs Sierra-Pacific Mental Illness Research, Education, and Clinical Center, Palo Alto, CA 94304
aaddress correspondence to this author at: Neuroscience Research Laboratories, Department of Psychiatry and Behavioral Sciences, MSLS P-104, Stanford University School of Medicine, Stanford, CA 94305-5485; fax 650-725-5714, e-mail gmurphy{at}stanford.edu
 |
Introduction |
|---|
 Top Introduction References |
|---|
) into the amplicon using a forward primer with a 3' single-nucleotide mismatch (underlined and in bold). The primers 2D6–1496F [gcctggacaacttggaagaact; modified from the forward primer upf14 described by Raimundo et al. (2)] and 2D6–1496R3 (gtgccaccacgtctagcttt) (5) amplify a 203-bp amplicon.
The following were mixed with 1 µL of genomic DNA at 0.23–1.1 µg/µL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 µL: 2.5 µL of 10x PCR buffer (Applied Biosystems); 0.5 µL of 10 mM dNTP (Amersham Pharmacia Biotech); 0.1 µL of each primer at 100 pmol/µL; and 0.25 µL of Taq polymerase at 5 U/µL (Applied Biosystems). After an initial 5-min denaturing step at 94 °C, the reaction mixture went through 40 cycles of PCR (94 °C for 30 s, 64 °C for 30 s, and 72 °C for 30 s), followed by a final extension at 72 °C for 10 min; 5 µL of this PCR product was digested with 0.5 µL of 5 U/µL BsrI (New England Biolabs), 1.5 µL of 10x NEBuffer 3, and 8 µL of water for at least 2 h at 65 °C. The digested samples were then assayed for 1 h on a 2% agarose gel in a field of 4 V/cm (Fig. 1
).
|
Allele C remained undigested, yielding the 203-bp amplicon, whereas allele G was cut, yielding 177- and 26-bp fragments. We selected the PCR products from four C/C, three G/G, and four C/G samples for DNA sequencing (Biotech Core) by primer extension using the reverse primer. For all samples, direct sequencing confirmed the BsrI genotype.
Raimundo et al. (2) observed an exclusive association of the G allele with the CYP2D6 *2 allele. As an early confirmation of our genotyping method, we looked at this association, and indeed, found that all samples that were found to be G/G homozygous according to our assay were either homozygous for *2 (n = 10) or had one *2 allele and one deletion allele (CYP2D6 *5; n = 6). Furthermore, 10 of 10 samples lacking the *2 allele were also found to lack the G variant.
In a previous sampling of 221 Caucasians, we detected 109 heterozygotes for the *2 allele and 22 homozygotes, using the Affymetrix GeneChip CYP450 system (Affymetrix; unpublished observations). All procedures were approved by the Stanford Medical Human Subjects Committee, and all participants provided informed consent. The *2 allele frequency in this sample thus was 0.346, close to the 0.324 reported by Sachse et al. (3). According to the method described here, 111 of the 153 chromosomes harboring *2 alleles showed the G variant of the C-1496C polymorphism. The overall frequency of the G allele was thus 0.25 in this sample. Raimundo et al. (2) estimated a G allele frequency of 0.19 in 39 people studied (ethnicity not specified).
We were concerned that we might be amplifying the rare pseudogene CYP2D7BP because sequence comparisons indicated that our primers had essentially 100% identity with CYP2D7BP (6)(7) (GenBank Accession No. X58468). We undertook two courses of action to try to resolve this issue. First, we took advantage of the fact that published sequences of CYP2D6 (GenBank Accession No. M33388) and CYP2D7 differ at nucleotide -1338, which lies 6 nucleotides upstream from our reverse primer. CYP2D6 has a C at this position, whereas CYP2D7 has a T. The PCR product from six samples were selected to be sequenced (Biotech Core) by primer extension with the forward primer. In each instance, a "C" was determined to lie at position -1338.
We also knew that the reverse primer used by the Affymetrix GeneChip CYP450 system for amplifying exons 1 and 2 of CYP2D6 (which we called 2D6ex1–2 R) has no significant homology with CYP2D7BP (6). When used with the primer upf14 (2), 2D6ex1–2 R should amplify CYP2D6 exclusively. Thus, if we used the amplicon generated by upf14 and 2D6ex1–2 R as the starting material for our 2D6–1496F/R3 PCR, then any amplicon would have to be derived from CYP2D6. Eighteen samples were tested with both the 2D6–1496F/R3 method and the nested PCR method, and the two methods yielded identical genotypes.
The nested PCR was executed as follows: 7.5 µL of 3.3x L Buffer II PCR buffer (Applied Biosystems), 1.0 µL of 25 mM Mg(OAc)2 (Applied Biosystems), 0.5 µL of 10 mM dNTP (Amersham), 0.25 µL of primer upf14 (gcctggacaacttggaagaacc) at 100 pmol/µL, 0.25 µL of primer 2D6ex1–2 R (ggtcccacggaaatctgtctctgt) at 100 pmol/µL; and 0.5 µL of rTth polymerase at 2 U/µL (Applied Biosystems) were mixed with 1 µL of genomic DNA at 0.23–1.1 µg/µL (extracted from whole blood using a Gentra reagent set) in a total volume of 25 µL. After an initial 1-min denaturation at 93 °C, the reaction mixture went through 35 cycles of PCR (93 °C for 1 min, 63 °C for 30 s, and 72 °C for 2.5 min), followed by a final extension at 72 °C for 10 min. After the amplicon was confirmed to be 2701 bp by electrophoresis on a 1% agarose gel, 2 µL of the remaining amplicon was diluted to 1:11 in 1x PCR buffer (Applied Biosystems), and 1 µL of this diluted product was used as the starting material for the 2D6–1496F/R3 PCR described above.
In summary, our method provides a simple means for detecting the C-1496G polymorphism in the CYP2D6 *2 allele, which should be useful in genotype–phenotype correlation studies.
|
Acknowledgments |
|---|
|
References |
|---|
|
TopIntroductionReferences |
|---|
The following articles in journals at HighWire Press have cited this article:
|
|
 |
|
  G. M. Murphy Jr Application of microarray technology in psychotropic drug trials J Psychopharmacol, July 1, 2006; 20(4_suppl): 72 - 78. [Abstract] [PDF]
|
|
|
|
 |
|
 G. M. Murphy Jr., C. Kremer, H. E. Rodrigues, and A. F. Schatzberg Pharmacogenetics of Antidepressant Medication Intolerance Am J Psychiatry, October 1, 2003; 160(10): 1830 - 1835. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-H. Chou, F.-X. Yan, D. K. Robbins-Weilert, T. B. Ryder, W. W. Liu, C. Perbost, M. Fairchild, J. de Leon, W. H. Koch, and P. J. Wedlund Comparison of Two CYP2D6 Genotyping Methods and Assessment of Genotype-Phenotype Relationships Clin. Chem., April 1, 2003; 49(4): 542 - 551. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
