|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Molecular Diagnostics and Genetics |
Departments of1 Chemical Pathology, 2 Paediatrics, 3 Medicine and Therapeutics, and 4 Microbiology, The Chinese University of Hong Kong, Prince of Wales Hospital, Hong Kong Special Administrative Region, China
aAddress correspondence to this author at: Department of Chemical Pathology, The Chinese University of Hong Kong, Room 38023, 1/F Clinical Sciences Bldg., Prince of Wales Hospital, 30-32 Ngan Shing St., Shatin, New Territories, Hong Kong Special Administrative Region, China. E-mail loym{at}cuhk.edu.hk.
| Abstract |
|---|
|
|
|---|
Methods: We developed two real-time quantitative reverse transcription-PCR (RT-PCR) assays, one for the polymerase and the other for the nucleocapsid region of the virus genome, for measuring the concentration of SARS-CoV RNA in serum/plasma samples from SARS patients. Plasma samples were obtained from 12 confirmed SARS patients on the day of hospital admission, as well as on days 7 and 14 after fever onset. Serum samples were also obtained from 23 confirmed SARS patients on the day of hospital admission, 11 of whom subsequently required intensive care. Viral RNA was extracted from the plasma/serum samples. The extracted RNA was subjected to analysis by the RT-PCR assays.
Results: The RT-PCR system for the polymerase region detected SARS-CoV RNA in 50% of plasma and 78% of serum samples from SARS patients during the first week of illness. The detection rates for plasma dropped to 25% at day 14 after fever onset. The median serum SARS-CoV concentrations in patients who required and did not require intensive care unit admission during the course of hospitalization were 5800 and 140 copies/mL, respectively (MannWhitney test, P <0.005). These data were confirmed by the RT-PCR system for the nucleocapsid region, which showed an even higher detection rate of 87%. The correlation between the results obtained by the two RT-PCR systems was high (Pearson correlation analysis, r = 0.998; P <0.001).
Conclusion: Plasma/serum SARS-CoV quantification represents a potentially useful early diagnostic and prognostic tool for SARS.
| Introduction |
|---|
|
|
|---|
Using the publicly released full genomic sequences of SARS-CoV (9)(10)(11), we have developed real-time RT-PCR assays specifically targeting two different regions of the SARS-CoV genome. In this study, we investigated whether SARS-CoV RNA can be detected in serum or plasma samples during the early stages of SARS without ultracentrifugation and studied the potential prognostic implications of such an approach.
| Patients and Methods |
|---|
|
|
|---|
In the first part of this study, blood samples were collected from 12 SARS patients on the day of hospital admission, as well as on days 7 and 14 after fever onset. Informed consent was obtained from the patients, and ethics approval was obtained from the Institutional Review Board. In the second part of this study, blood samples were obtained from 23 SARS patients on the day of hospital admission. All studied patients had subsequent serologic evidence of antibodies to SARS-CoV. For the prognostic part of the study, the previously mentioned 23 SARS patients were subdivided into two patient groups: (a) 11 patients who required admission to the intensive care unit (ICU) and (b) 12 patients who did not require ICU admission (non-ICU) during the duration of their hospitalization.
processing of blood samples
Blood samples were collected in EDTA-containing or plain tubes. The plain bottles were allowed to stand at room temperature for 2 h for complete clotting of blood. The blood samples were then centrifuged at 1600g for 10 min at 4 °C. Plasma or serum was then carefully transferred to plain polypropylene tubes. The plasma samples were recentrifuged at 16 000g for 10 min at 4 °C, and the supernatants were collected in fresh polypropylene tubes.
rna extraction
Viral RNA was extracted from 0.28 mL of plasma/serum with use of a QIAamp viral RNA mini reagent set (Qiagen) according to the manufacturers recommendations. RNA was eluted with 50 µL of AVE buffer (included in the reagent set) and stored at -80 °C.
real-time quantitative rt-pcr
One-step, real-time quantitative RT-PCR was used for SARS-CoV RNA quantification. We used the publicly released full genomic sequences of SARS-CoV (http://www.ncbi.nlm.nih.gov) to design two RT-PCR systems specifically targeting the SARS-CoV genome. The sequences of the primers and probes showed perfect alignment with all publicly available complete genome sequences of SARS-CoV on GenBank as of July 23, 2003 (accession nos. AY338175, AY338174, NC_004718, AY321118, AY323977, AY283798, AY283797, AY283796, AY283795, AY283794, AY291315, AY279354, AY278490, AY278487, AY278489, AY278554, AY297028, AY274119, AY291451, AY282752, AY278488, AY278741, and AY278491). The SARSPol1 system targeted the polymerase gene (orf1ab polyprotein; nucleotides 1532715398; accession no. AY278554), and the SARSN system targeted the nucleocapsid gene (N; nucleotides 2875828823; accession no. AY278554) of the SARS-CoV genome. The SARSPol1 primer sequences were 5'-GAGTGTGCGCAAGTATTAAGTGA-3' (forward) and 5'-TGATGTTCCACCTGGTTTAACA-3' (reverse), and the dual-labeled fluorescent probe was 5'-(FAM)ATGGTCATGTGTGGCGGCTCACTA(TAMRA)-3', where FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine. The SARSN primer sequences were 5'-TGCCCTCGCGCTATTG-3' (forward) and 5'-GGCCTTTACCAGAAACTTTGC-3' (reverse), and the dual-labeled fluorescent probe was 5'-(FAM)TGCTAGACAGATTGAACCAGCTTG(TAMRA)-3'. Calibration curves for SARS-CoV RNA quantification were prepared with serial dilutions of a HPLC-purified single-stranded synthetic DNA oligonucleotide (PROLIGO), with concentrations ranging from 1 x 107 to 1 x 100 copies. The initial concentration of the synthetic oligonucleotide was determined by measuring the absorbance at 260 and 280 nm. The assay was able to detect 5 copies of the calibrator target in the reaction mixture, as indicated in Figs. 1 and 2 in the Data Supplement that accompanies the online version of this article athttp://www.clinchem.org/content/vol49/issue12/. Concentrations of SARS-CoV were expressed as copies/mL of plasma/serum.
Because no recovery experiments had been done, the reported concentrations (copies/mL) were minimum estimates. The sequences of the synthetic DNA oligonucleotides for SARSPol1 and SARSN calibrations were 5'-AACGAGTGTGCGCAAGTATTAAGTGAGATGGTCATGTGTGGCGGCTCACTATATGTTAAACCAGGTGGAACATCATCCGG-3' and 5'-GAAACTGCCCTCGCGCTATTGCTGCTAGACAGATTGAACCAGCTTGAGAGCAAAGTTTCTGGTAAAGGCCAACAA-3', respectively.
The RT-PCR reactions were set up according to the manufacturers instructions (EZ rTth RNA PCR reagent set; Applied Biosystems) in a reaction volume of 25 µL. The primers and fluorescent probes were used at concentrations of 300 and 100 nM, respectively, and 12 µL of extracted plasma/serum RNA was used for amplification. The thermal profile used for the analysis was as follows: the reaction was initiated at 50 °C for 2 min for the included uracil N-glycosylase to act, followed by reverse transcription at 60 °C for 30 min. After a 5-min denaturation at 95 °C, 40 cycles of PCR were carried out with denaturation at 94 °C for 20 s and annealing/extension for 1 min at 56 °C. Each sample was analyzed in duplicate, and the calibration curve was run in parallel for each analysis. Multiple negative water blanks were also included in every analysis.
statistical analysis
Statistical analysis was performed with SigmaStat 2.03 software (SPSS). The Student t-test was used for the comparison of the ages of the ICU and non-ICU groups, and the MannWhitney test was used for the comparison of serum SARS-CoV RNA concentrations between the ICU and non-ICU groups. Pearson correlation analysis was used to assess the correlation of SARS-CoV RNA concentrations between the SARSPol1 and SARSN RT-PCR systems.
| Results |
|---|
|
|
|---|
To determine the precision of the whole analytical procedure, including RNA extraction, reverse transcription, and amplification, we performed 10 replicate RNA extractions from a sample pooled from plasma obtained from 5 SARS patients and subjected these extracted RNA samples to RT-PCR assays. The CV of the copy number of these replicate analyses for the SARSPol1 and SARSN amplification systems were 16% at 280 copies/mL and 15% at 320 copies/mL, respectively. Because we had not carried out recovery experiments, the actual virus concentrations in the tested samples would be expected to be higher than the actual concentrations measured by real-time RT-PCR. However, this would not affect the interpretation of our data because the reproducibility of the RNA extraction and quantitative RT-PCR steps had been tested as detailed above and our system would serve as a reproducible and valid comparison of the virus concentrations within a patient at different times and between different patients.
detectability of plasma sars-COVrna at different stages of the disease
To investigate whether SARS-CoV RNA could be detected in plasma and to evaluate the relative usefulness of plasma SARS-CoV measurements at different stages of the disease, we studied 12 serologically confirmed SARS patients. Plasma samples were taken on admission, representing a mean of 3.6 days after fever onset (range, 16 days). Additional samples were taken from each of these patients at days 7 and 14 after fever onset. The SARSPol1 real-time RT-PCR system detected plasma SARS-CoV RNA above the detection limit, as determined by the serially diluted calibrator, in six patients on admission (50%). The detection rate remained at 50% (6 of 12) at day 7 and fell to 25% (3 of 12) at day 14 after fever onset (Table 1
). As negative controls, SARS-CoV RNA was not detected in the plasma samples obtained from 40 healthy individuals.
|
quantitative analysis of sars-COVrna in sera of sars patients
To test the detectability of SARS-CoV RNA in serum, instead of plasma, during the early stage of SARS, we analyzed 23 serum samples obtained from SARS patients on the day of hospital admission, using the SARSPol1 real-time RT-PCR system. For 22 patients, the serum samples were taken at a mean of 2.6 days (range, 16 days) after the onset of fever. One patient did not have fever during his illness. The SARSPol1 system was able to detect SARS-CoV RNA in 18 of the 23 samples (78%), including the patient who did not have fever. The detection rate essentially confirmed the plasma-based results from our first cohort as described above. The median serum SARS-CoV RNA concentration was 752 copies/mL. As negative controls, SARS-CoV RNA was not detected in serum samples obtained from 30 healthy individuals.
corroborative data from a second rt-pcr system
To confirm the data generated by the SARSPol1 RT-PCR system, we used another real-time RT-PCR system (SARSN) targeting the nucleocapsid gene of the SARS-CoV genome to repeat the serum analysis. The SARSN system was able to detect SARS-CoV RNA in 20 of the 23 samples (87%). The median serum SARS-CoV RNA concentration was 3900 copies/mL. The correlation coefficient for SARS-CoV RNA concentrations between the SARSPol1 and SARSN RT-PCR systems was 0.998 (Pearson correlation analysis; P <0.001; Fig. 1
). As negative controls, SARS-CoV RNA was not detected by the SARSN RT-PCR system in serum samples obtained from 30 healthy individuals.
|
prognostic implications
To determine the potential prognostic implications of the admission serum SARS-CoV concentration, the previously mentioned group of 23 patients was stratified into those who required admission to the ICU (n = 11) and those who did not (n = 12) during the duration of their hospitalization. The mean ages of the two groups of patients were 56 and 47 years, respectively (Student t-test, P = 0.188). The male-to-female ratios were 5:6 for the ICU group and 6:6 for the non-ICU group. For the SARSPol1 RT-PCR assay, the median serum SARS-CoV concentrations in the ICU and non-ICU groups were 5800 and 140 copies/mL, respectively (see Fig. 4 in the online Data Supplement). The difference in the serum SARS-CoV concentrations between these groups was statistically significant (MannWhitney test, P <0.005). For the SARSN RT-PCR assay, the median serum SARS-CoV concentrations in the ICU and non-ICU groups were 23 000 and 870 copies/mL, respectively (see Fig. 4 in the online Data Supplement). The difference in serum SARS-CoV concentrations between these groups was also statistically significant (MannWhitney test, P <0.007).
| Discussion |
|---|
|
|
|---|
The data presented here also demonstrated that the median concentrations of serum SARS-CoV RNA in patients who required ICU admission during the course of hospitalization were 30- and 26-fold higher than the median concentrations in those who did not require intensive care, as measured by the SARSPol1 and SARSN RT-PCR systems, respectively. Our results showed that there is a strong correlation between the serum SARS-CoV RNA concentrations obtained by the SARSPol1 and those obtained by the SARSN RT-PCR system, although the median serum SARS-CoV concentrations differed. The differences observed in the quantitative values may be a result of the coexistence of subgenomic fragments of the N gene with the full virus genome in serum. This could be a subject of further investigation.
We envision that plasma/serum SARS-CoV measurements can function in a synergistic manner with existing diagnostic strategies for SARS. Thus, plasma/serum RT-PCR can be performed with high sensitivity during the first week of the disease, RT-PCR analysis of stool and respiratory samples can be performed during the second week, and serologic testing for antibodies against SARS-CoV can be used from day 21 onward (6). The availability of a diagnostic test for the early identification of SARS patients could potentially be useful in the public health control of SARS. Furthermore, our data show that serum SARS-CoV measurement is a prognostic marker that can be used even on the first day of hospital admission. Apart from its obvious clinical significance, this observation also suggests that a high systemic viral load may lead to more severe tissue damage either directly or indirectly through the activation of a potentially damaging immune reaction. Elucidation of the latter possibility would be fertile ground for future research.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
The following articles in journals at HighWire Press have cited this article:
![]() |
J. Dong, J. P. Olano, J. W. McBride, and D. H. Walker Emerging Pathogens: Challenges and Successes of Molecular Diagnostics J. Mol. Diagn., May 1, 2008; 10(3): 185 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T.K. Pang, T. C.W. Poon, K.C. A. Chan, N. L.S. Lee, R. W.K. Chiu, Y.-K. Tong, R. M.Y. Wong, S. S.C. Chim, S. M. Ngai, J. J.Y. Sung, et al. Serum Proteomic Fingerprints of Adult Patients with Severe Acute Respiratory Syndrome Clin. Chem., March 1, 2006; 52(3): 421 - 429. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L.-S. Tang, P. K.-S. Chan, C.-K. Wong, K.-F. To, A. K.-L. Wu, Y.-M. Sung, D. S.-C. Hui, J. J.-Y. Sung, and C. W.-K. Lam Early Enhanced Expression of Interferon-Inducible Protein-10 (CXCL-10) and Other Chemokines Predicts Adverse Outcome in Severe Acute Respiratory Syndrome Clin. Chem., December 1, 2005; 51(12): 2333 - 2340. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Vijgen, E. Keyaerts, E. Moes, P. Maes, G. Duson, and M. Van Ranst Development of One-Step, Real-Time, Quantitative Reverse Transcriptase PCR Assays for Absolute Quantitation of Human Coronaviruses OC43 and 229E J. Clin. Microbiol., November 1, 2005; 43(11): 5452 - 5456. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. P. Yip, S. S. T. To, P. H.M. Leung, T. S. Cheung, P. K.C. Cheng, and W. W.L. Lim Use of Dual TaqMan Probes to Increase the Sensitivity of 1-Step Quantitative Reverse Transcription-PCR: Application to the Detection of SARS Coronavirus Clin. Chem., October 1, 2005; 51(10): 1885 - 1888. [Full Text] [PDF] |
||||
![]() |
B. Kan, M. Wang, H. Jing, H. Xu, X. Jiang, M. Yan, W. Liang, H. Zheng, K. Wan, Q. Liu, et al. Molecular Evolution Analysis and Geographic Investigation of Severe Acute Respiratory Syndrome Coronavirus-Like Virus in Palm Civets at an Animal Market and on Farms J. Virol., September 15, 2005; 79(18): 11892 - 11900. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Ho, P. H. Chau, P. S. F. Yip, G. C. Ooi, P. L. Khong, J. C. Ho, P. C. Wong, C. Ko, C. Yan, and K. W. Tsang A prediction rule for clinical diagnosis of severe acute respiratory syndrome Eur. Respir. J., September 1, 2005; 26(3): 474 - 479. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Greenough, A. Carville, J. Coderre, M. Somasundaran, J. L. Sullivan, K. Luzuriaga, and K. Mansfield Pneumonitis and Multi-Organ System Disease in Common Marmosets (Callithrix jacchus) Infected with the Severe Acute Respiratory Syndrome-Associated Coronavirus Am. J. Pathol., August 1, 2005; 167(2): 455 - 463. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Hu, B. Bai, Z. Hu, Z. Chen, X. An, L. Tang, J. Yang, H. Wang, and H. Wang Development and Evaluation of a Multitarget Real-Time Taqman Reverse Transcription-PCR Assay for Detection of the Severe Acute Respiratory Syndrome-Associated Coronavirus and Surveillance for an Apparently Related Coronavirus Found in Masked Palm Civets J. Clin. Microbiol., May 1, 2005; 43(5): 2041 - 2046. [Abstract] [Full Text] [PDF] |
||||
![]() |
I-J. Liu, P.-J. Chen, S.-H. Yeh, Y.-P. Chiang, L.-M. Huang, M.-F. Chang, S.-Y. Chen, P.-C. Yang, S.-C. Chang, W.-K. Wang, et al. Immunofluorescence Assay for Detection of the Nucleocapsid Antigen of the Severe Acute Respiratory Syndrome (SARS)-Associated Coronavirus in Cells Derived from Throat Wash Samples of Patients with SARS J. Clin. Microbiol., May 1, 2005; 43(5): 2444 - 2448. [Abstract] [Full Text] [PDF] |
||||
![]() |
S C C Wong, J K C Chan, K C Lee, E S F Lo, and D N C Tsang Development of a quantitative assay for SARS coronavirus and correlation of GAPDH mRNA with SARS coronavirus in clinical specimens J. Clin. Pathol., March 1, 2005; 58(3): 276 - 280. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-K. Wang, C.-T. Fang, H.-L. Chen, C.-F. Yang, Y.-C. Chen, M.-L. Chen, S.-Y. Chen, J.-Y. Yang, J.-H. Lin, P.-C. Yang, et al. Detection of Severe Acute Respiratory Syndrome Coronavirus RNA in Plasma during the Course of Infection J. Clin. Microbiol., February 1, 2005; 43(2): 962 - 965. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Kang, Y. Xu, X. Wu, Y. Liang, C. Wang, J. Guo, Y. Wang, M. Chen, D. Wu, Y. Wang, et al. Proteomic Fingerprints for Potential Application to Early Diagnosis of Severe Acute Respiratory Syndrome Clin. Chem., January 1, 2005; 51(1): 56 - 64. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T.C. Yip, J. W.M. Chan, W. C.S. Cho, T.-T. Yip, Z. Wang, T.-L. Kwan, S. C.K. Law, D. N.C. Tsang, J. K.C. Chan, K.-C. Lee, et al. Protein Chip Array Profiling Analysis in Patients with Severe Acute Respiratory Syndrome Identified Serum Amyloid A Protein as a Biomarker Potentially Useful in Monitoring the Extent of Pneumonia Clin. Chem., January 1, 2005; 51(1): 47 - 55. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.W. Tsang, G.C. Ooi, and P.L. Ho Diagnosis and pharmacotherapy of severe acute respiratory syndrome: what have we learnt? Eur. Respir. J., December 1, 2004; 24(6): 1025 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-M. Chu, L. L.M. Poon, V. C.C. Cheng, K.-S. Chan, I. F.N. Hung, M. M.L. Wong, K.-H. Chan, W.-S. Leung, B. S.F. Tang, V. L. Chan, et al. Initial viral load and the outcomes of SARS Can. Med. Assoc. J., November 23, 2004; 171(11): 1349 - 1352. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Leung, T. H. Rainer, F.-L. Lau, I. O.L. Wong, A. Tong, T.-W. Wong, J. H.B. Kong, A. J. Hedley, T.-H. Lam, and for the Hospital Authority SARS Collaborative Grou A Clinical Prediction Rule for Diagnosing Severe Acute Respiratory Syndrome in the Emergency Department Ann Intern Med, September 7, 2004; 141(5): 333 - 342. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S.C. Hui and J. J.Y. Sung Treatment of Severe Acute Respiratory Syndrome Chest, September 1, 2004; 126(3): 670 - 674. [Full Text] [PDF] |
||||
![]() |
T. C.W. Poon, K.C. A. Chan, P.-C. Ng, R. W.K. Chiu, I. L. Ang, Y.-k. Tong, E. K.O. Ng, F. W.T. Cheng, A. M. Li, E. K.L. Hon, et al. Serial Analysis of Plasma Proteomic Signatures in Pediatric Patients with Severe Acute Respiratory Syndrome and Correlation with Viral Load Clin. Chem., August 1, 2004; 50(8): 1452 - 1455. [Full Text] [PDF] |
||||
![]() |
H. Wang, Y. Mao, L. Ju, J. Zhang, Z. Liu, X. Zhou, Q. Li, Y. Wang, S. Kim, and L. Zhang Detection and Monitoring of SARS Coronavirus in the Plasma and Peripheral Blood Lymphocytes of Patients with Severe Acute Respiratory Syndrome Clin. Chem., July 1, 2004; 50(7): 1237 - 1240. [Full Text] [PDF] |
||||
![]() |
D S C Hui, M C H Chan, A K Wu, and P C Ng Severe acute respiratory syndrome (SARS): epidemiology and clinical features Postgrad. Med. J., July 1, 2004; 80(945): 373 - 381. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Y. Choy, S.-G. Lin, P. K.-S. Chan, J. S.-L. Tam, Y.M. D. Lo, I. M.-T. Chu, S.-N. Tsai, M.-Q. Zhong, K.-P. Fung, M. M.-Y. Waye, et al. Synthetic Peptide Studies on the Severe Acute Respiratory Syndrome (SARS) Coronavirus Spike Glycoprotein: Perspective for SARS Vaccine Development Clin. Chem., June 1, 2004; 50(6): 1036 - 1042. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K.O. Ng, P.-C. Ng, K.L. E. Hon, W.T. F. Cheng, E. C.W. Hung, K.C. A. Chan, R. W.K. Chiu, A. M. Li, L. L.M. Poon, D. S. Hui, et al. Serial Analysis of the Plasma Concentration of SARS Coronavirus RNA in Pediatric Patients with Severe Acute Respiratory Syndrome Clin. Chem., December 1, 2003; 49(12): 2085 - 2088. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |