|
|
||||||||
Departments of
1
Chemical Pathology and
2 Obstetrics and Gynaecology, The Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, New Territories, Hong Kong SAR.
aAuthor for correspondence. Fax 852-2194-6171; e-mail loym{at}cuhk.edu.hk.
| Abstract |
|---|
|
|
|---|
Methods: We developed a real-time quantitative reverse transcription-PCR assay to measure the concentration of the mRNA of the corticotropin-releasing hormone (CRH) locus. Peripheral blood samples were obtained from healthy pregnant women both before and 2 h after delivery. Peripheral blood samples were also obtained from women suffering from preeclampsia and controls matched for gestational age. Plasma was harvested from these samples, and RNA was extracted. Plasma RNA was subjected to analysis by the reverse transcription-PCR assay.
Results: CRH mRNA was detected in the plasma of 10 healthy pregnant women in the third trimester. CRH mRNA was found to be cleared very rapidly after cesarean section, with no detectable signal by 2 h postpartum. Plasma CRH mRNA concentrations were 1070 and 102 copies/mL, respectively, in 12 preeclamptic women and 10 healthy pregnant women matched for gestational age (MannWhitney test, P <0.001).
Conclusion: Plasma CRH mRNA represents a new molecular marker for preeclampsia. Maternal plasma RNA is gender- and polymorphism-independent and may allow noninvasive gene-expression profiling of an unborn fetus.
| Introduction |
|---|
|
|
|---|
The demonstration of the presence of fetal RNA in maternal plasma provides an approach for detecting fetal nucleic acids in maternal plasma that is independent of the gender and genetic polymorphisms present in a fetus (12)(13). Recently, methods to enhance our ability to use plasma RNA as a potential molecular diagnostic tool have been developed. Our group has developed a protocol for the quantitative analysis of plasma RNA (14), demonstrated the unexpected stability of circulating RNA (15), and shown that the placenta is an important source of fetal RNA in maternal plasma (16).
In this study, we tested the hypothesis that the ability to measure plasma RNA would provide us with a gender- and polymorphism-independent marker for monitoring pregnancy-associated disorders. Because of its importance, we chose preeclampsia as our model system (17). For the mRNA target, we chose the mRNA of the corticotropin-releasing hormone (CRH) 1 locus, which is known to be expressed in the placenta (18) and is released into the maternal circulation (19)(20). Its exact role in human pregnancy is not yet fully understood. A significantly higher CRH peptide content has been reported in placentas of preeclamptic pregnancies (21)(22). Abnormally increased maternal plasma CRH has also been reported by various groups in pregnancies complicated by preeclampsia (23)(24)(25). In this study, we investigated whether maternal plasma CRH mRNA might also be increased in preeclamptic pregnancies; if this hypothesis is confirmed, then plasma CRH mRNA might represent a new noninvasive marker for preeclampsia.
| Patients and Methods |
|---|
|
|
|---|
In the first part of this study, blood samples were obtained from 10 healthy pregnant women during the third trimester of gestation. In the second part of the project, pregnant women with uncomplicated pregnancies were recruited just before elective cesarean section. Peripheral blood samples were taken from these women just before delivery and at 2 h postdelivery. In the third part of the study, two patient groups were studied: (a) 12 preeclamptic women, and (b) 10 control pregnancies. The median gestational ages of the preeclamptic and control groups were 37 weeks (interquartile range, 36.638.9 weeks) and 38 weeks (interquartile range, 37.338.3 weeks), respectively. Preeclampsia was defined on the basis of a sustained increase in diastolic blood pressure >110 mmHg on one occasion or >90 mmHg on two or more occasions at least 4 h apart, with the presence of significant proteinuria in women with no history of hypertension. Significant proteinuria was defined as proteinuria >0.3 g/day or
2+ on dipstick testing in two clean-catch midstream urine specimens collected at least 4 h apart. The control group included pregnant women with no preexisting medical diseases or antenatal complications.
processing of blood samples
Plasma harvesting was performed immediately on arrival at the laboratory (within 1 h of venesection). Blood samples were processed based on a previously reported protocol (14). In brief, 10-mL blood samples were collected in EDTA-containing tubes and centrifuged at 1600g for 10 min at 4 °C. Plasma was then carefully transferred into plain polypropylene tubes. The plasma samples were recentrifuged at 16 000g for 10 min at 4 °C, and the supernatants were collected in fresh polypropylene tubes.
rna extraction
We mixed 1.6 mL of plasma harvested after the centrifugation steps described above with 2 mL of Trizol LS reagent (Invitrogen) and 0.4 mL of chloroform (14). The mixture was centrifuged at 11 900g for 15 min at 4 °C, and the aqueous layer was transferred to new tubes. One volume of 700 mL/L ethanol was added to one volume of the aqueous layer. The mixture was then applied to an RNeasy mini column (Qiagen) and processed according to the manufacturers recommendations. Total RNA was eluted with 30 µL of RNase-free water and stored at -80 °C. DNase treatment (RNase-Free DNase Set; Qiagen) was carried out to remove any contaminating DNA.
real-time quantitative reverse transcription-pcr
One-step real-time quantitative reverse transcription-PCR (RT-PCR) was used for all mRNA quantifications (14). The CRH primer sequences were 5'-GCCTCCCATCTCCCTGGAT-3' (forward) and 5'-TGTGAGCTTGCTGTGCTAACTG-3' (reverse), and the dual-labeled fluorescent probe was 5'-(FAM)TCCTCCGGGAAGTCTTGGAAATGGC(TAMRA)-3', where FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine. Calibration curves for CRH mRNA quantification were prepared by assaying serial dilutions of HPLC-purified single-stranded synthetic DNA oligonucleotides (Genset Oligos) specifying a 89-bp CRH amplicon (GenBank Accession No. NM_000756), with concentrations ranging from 1 x 107 copies to 1 x 101 copies. Absolute concentrations of CRH mRNA were expressed as copies/mL of plasma. The sequence of the synthetic DNA oligonucleotides for CRH calibrations was 5'-GGAGCCTCCCATCTCCCTGGATCTCACCTTCCACCTCCTCCGGGAAGTCTTGGAAATGGCCAGGGCCGAGCAGTTAGCACAGCAAGCTCACAGCA-3'. A calibration curve for glyceraldehyde-3-phosphate dehydrogenase (GAPDH) quantification was prepared as described previously, with results expressed in pg/mL of plasma (14).
The RT-PCR reactions were set up according to the manufacturers instructions (EZ rTth RNA PCR reagent set; Applied Biosystems) in a reaction volume of 25 µL. The fluorescent probes (Genset Oligos) were used at concentrations of 100 nM. The PCR primers (Genset Oligos) were used at a concentration of 200 nM for both the CRH and GAPDH systems. We used 5 µL of extracted plasma RNA for amplification. Each sample was analyzed in duplicate, and the corresponding calibration curve was run in parallel with each analysis. Samples were also tested to ensure that they were negative for DNA by substituting the rTth polymerase with the AmpliTaq Gold enzyme (Applied Biosystems). No amplification was observed for this control analysis, indicating the specificity of the assays for the respective mRNAs. Multiple negative water blanks were also included in every analysis. All analyses were performed by two of the authors (E.K.O.N. and N.B.Y.T.).
The thermal profile used for the CRH and GAPDH analyses was as follows: the reaction was initiated at 50 °C for 2 min for the included uracil N-glycosylase to act, followed by reverse transcription at 60 °C for 30 min. After a 5-min denaturation at 95 °C, 40 cycles of PCR were carried out with denaturation at 94 °C for 20 s and 1 min of annealing/extension at 58 and 62 °C for CRH and GAPDH, respectively.
statistical analysis
Statistical analysis was performed with the Sigma Stat 2.03 software (SPSS). The MannWhitney test was used for the comparison of maternal plasma CRH mRNA concentrations between preeclamptic and control groups. The Wilcoxon test was used for the comparison of maternal plasma GAPDH mRNA concentrations before and at 2 h postdelivery.
| Results |
|---|
|
|
|---|
detectability of crh MRNA in maternal plasma
To test whether CRH mRNA transcripts were detectable in maternal plasma, we analyzed plasma samples from 10 pregnant women in the third trimester of pregnancy (gestational age, 3741 weeks) by the CRH RT-PCR assay. CRH mRNA was detected in all tested samples. The median concentration of plasma CRH mRNA was 73 copies/mL (interquartile range, 51177 copies/mL). As a positive control, GAPDH mRNA was also detectable in all of these plasma samples.
clearance of crh MRNA from maternal plasma after delivery
To demonstrate that the maternal plasma CRH mRNA was derived from the fetus, we analyzed maternal plasma for CRH mRNA both before and at 2 h postdelivery. Four women who delivered by cesarean section (gestational age, 3840 weeks) were studied. CRH mRNA was detected in 100% of predelivery maternal plasma samples, whereas CRH mRNA was not detected in any of the postdelivery samples. GAPDH mRNA was detectable in all plasma samples, thus demonstrating the quality of the samples. No systematic alternation in maternal plasma GAPDH mRNA concentration was observed (Wilcoxon test, P = 0.25). The results are shown in Fig. 1
.
|
quantitative analysis of crh MRNA in the plasma of preeclamptic pregnant women
To compare the concentration of CRH mRNA in maternal plasma of preeclamptic and control pregnant women, we obtained plasma samples from 12 preeclamptic women and 10 control pregnant women with matched gestational age. The median CRH mRNA concentration in the plasma of preeclamptic women and control pregnancies were 1070 copies/mL (interquartile range, 535-1468 copies/mL) and 102 copies/mL (interquartile range, 51158 copies/mL), respectively (Fig. 2
). The median plasma CRH mRNA concentrations were 10.5 times higher in preeclamptic than control pregnancies (MannWhitney test, P <0.001).
|
| Discussion |
|---|
|
|
|---|
We also considered the possibility that CRH mRNA produced by the mother, rather than the placenta, might also be detectable in the plasma, but the postpartum data suggest that this is improbable. Furthermore, because CRH is produced by the hypothalamus, we think that it is unlikely that large amounts of such mRNA will be released into the blood (possibly even requiring the passage of mRNA through the intact bloodbrain barrier). Conversely, the relatively large surface area of the placenta would make it a much more plausible source of CRH mRNA release.
The data presented here have demonstrated that the concentration of maternal plasma CRH mRNA is increased in pregnancies complicated with preeclampsia. The median plasma CRH mRNA concentration was increased 10.5 times in preeclampsia, compared with non-preeclamptic pregnancies matched for gestational age. In comparison, our previously published results showed a fivefold increase in circulating fetal DNA in maternal plasma in preeclamptic pregnancies (6).
Our results suggest that maternal plasma CRH mRNA might be a new molecular marker for preeclampsia. This approach offers an alternative to current studies that involve the measurement of maternal plasma CRH using immunoassays. For immunoassays, the specificity of the method is critically dependent on the specificity of the antibodies used. On the other hand, at least at the present time, the mRNA approach is probably more expensive on a case-by-case basis than a well-established immunoassay system. Future studies should aim at a direct comparison of these potentially complementary approaches in the same patient cohort.
The mechanism producing the increase in such quantitative aberration in plasma RNA requires further investigation. Several theoretical possibilities exist. The first is that increased concentrations of pro-CRH mRNA have been detected in placental tissues in preeclamptic pregnancies (22), which may lead to increased liberation of such transcripts into the plasma. The second possibility is that, because plasma nucleic acids have been postulated to be related to cell death (27)(28)(29), it is possible that the increase in cell death within the placenta in preeclampsia (30) may contribute to the increased release of placenta-expressed mRNA species into maternal plasma. Concerning the third possibility, we have recently demonstrated that impaired clearance of maternal plasma fetal DNA is observed in preeclampsia (31). In theory, a similar phenomenon may also exist for plasma RNA clearance in preeclampsia. This is particularly relevant because the data in the present study demonstrate the rapid clearance of CRH mRNA after delivery (Fig. 1
), which is similar to the rapid clearance of fetal DNA from maternal plasma after delivery (32).
Compared with fetal DNA measurements in maternal plasma (6)(7)(8), quantitative analysis of circulating fetal RNA, such as placenta-expressed mRNA, has the advantage of being applicable to all pregnant women irrespective of fetal gender and polymorphism status. Furthermore, numerous targets can be selected for plasma RNA analysis, including the numerous genes that are known to be expressed in the placenta. It could therefore be worthwhile to systematically investigate the detectability of such transcripts in maternal plasma. In addition, because CRH is a hormone, our data have also opened up the possibility that a similar approach can be used for the investigation of other hormonal systems, with new diagnostic and research opportunities.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
-fetoprotein concentrations for predicting pre-eclampsia. Hum Reprod 2000;15:1813-1818.The following articles in journals at HighWire Press have cited this article:
![]() |
S. S.C. Chim, T. K.F. Shing, E. C.W. Hung, T.-y. Leung, T.-k. Lau, R. W.K. Chiu, and Y.M. Dennis Lo Detection and Characterization of Placental MicroRNAs in Maternal Plasma Clin. Chem., March 1, 2008; 54(3): 482 - 490. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Okazaki, A. Sekizawa, Y. Purwosunu, A. Farina, N. Wibowo, and T. Okai Placenta-Derived, Cellular Messenger RNA Expression in the Maternal Blood of Preeclamptic Women Obstet. Gynecol., November 1, 2007; 110(5): 1130 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Purwosunu, A. Sekizawa, K. Koide, A. Farina, N. Wibowo, G. H. Wiknjosastro, S. Okazaki, H. Chiba, and T. Okai Cell-Free mRNA Concentrations of Plasminogen Activator Inhibitor-1 and Tissue-Type Plasminogen Activator Are Increased in the Plasma of Pregnant Women with Preeclampsia Clin. Chem., March 1, 2007; 53(3): 399 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Y TSUI and Y. M DENNIS LO Placental RNA in Maternal Plasma: Toward Noninvasive Fetal Gene Expression Profiling. Ann. N.Y. Acad. Sci., September 1, 2006; 1075: 96 - 102. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Okazaki, A Sekizawa, Y Purwosunu, M Iwasaki, A Farina, and T Okai Measurement of mRNA of trophoblast-specific genes in cellular and plasma components of maternal blood. J. Med. Genet., September 1, 2006; 43(9): e47 - e47. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W.K. Chiu, W.-b. Lui, M.-c. Cheung, N. Kumta, A. Farina, I. Banzola, S. Grotti, N. Rizzo, C. J. Haines, and Y.M. D. Lo Time Profile of Appearance and Disappearance of Circulating Placenta-Derived mRNA in Maternal Plasma Clin. Chem., February 1, 2006; 52(2): 313 - 316. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C.K. Wong, R. W.K. Chiu, N. B.Y. Tsui, K.C. A. Chan, L. W. Chan, T. K. Lau, T. N. Leung, and Y.M. D. Lo Circulating Placental RNA in Maternal Plasma Is Associated with a Preponderance of 5' mRNA Fragments: Implications for Noninvasive Prenatal Diagnosis and Monitoring Clin. Chem., October 1, 2005; 51(10): 1786 - 1795. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Y. Zhong, S. Gebhardt, R. Hillermann, K. C. Tofa, W. Holzgreve, and S. Hahn Parallel Assessment of Circulatory Fetal DNA and Corticotropin-Releasing Hormone mRNA in Early- and Late-Onset Preeclampsia Clin. Chem., September 1, 2005; 51(9): 1730 - 1733. [Full Text] [PDF] |
||||
![]() |
G. T.Y. Chung, R. W.K. Chiu, K.C. A. Chan, T. K. Lau, T. N. Leung, L. W. Chan, and Y.M. D. Lo Detrimental Effect of Formaldehyde on Plasma RNA Detection Clin. Chem., June 1, 2005; 51(6): 1074 - 1076. [Full Text] [PDF] |
||||
![]() |
Y.M. D. Lo Recent Advances in Fetal Nucleic Acids in Maternal Plasma J. Histochem. Cytochem., March 1, 2005; 53(3): 293 - 296. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Y. Zhong, W. Holzgreve, I. Hoesli, and S. Hahn Circulatory Corticotropin-Releasing Hormone mRNA Concentrations Are Increased in Women with Preterm Delivery But Not in Those Who Respond to Tocolytic Treatment Clin. Chem., March 1, 2005; 51(3): 635 - 636. [Full Text] [PDF] |
||||
![]() |
S. K. R. Chinnapapagari, W. Holzgreve, O. Lapaire, B. Zimmermann, and S. Hahn Treatment of Maternal Blood Samples with Formaldehyde Does Not Alter the Proportion of Circulatory Fetal Nucleic Acids (DNA and mRNA) in Maternal Plasma Clin. Chem., March 1, 2005; 51(3): 652 - 655. [Full Text] [PDF] |
||||
![]() |
P. B. Larrabee, K. L. Johnson, C. Lai, J. Ordovas, J. M. Cowan, U. Tantravahi, and D. W. Bianchi Global Gene Expression Analysis of the Living Human Fetus Using Cell-Free Messenger RNA in Amniotic Fluid JAMA, February 16, 2005; 293(7): 836 - 842. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Farina, N. Rizzo, M. Concu, I. Banzola, A. Sekizawa, S. Grotti, and P. Carinci Lower Maternal PLAC1 mRNA in Pregnancies Complicated with Vaginal Bleeding (Threatened Abortion <20 Weeks) and a Surviving Fetus Clin. Chem., January 1, 2005; 51(1): 224 - 227. [Full Text] [PDF] |
||||
![]() |
A. K. Gupta, W. Holzgreve, B. Huppertz, A. Malek, H. Schneider, and S. Hahn Detection of Fetal DNA and RNA in Placenta-Derived Syncytiotrophoblast Microparticles Generated in Vitro Clin. Chem., November 1, 2004; 50(11): 2187 - 2190. [Full Text] [PDF] |
||||
![]() |
A. Farina, C. W.M. Chan, R. W.K. Chiu, N. B.Y. Tsui, P. Carinci, M. Concu, I. Banzola, N. Rizzo, and Y.M. D. Lo Circulating Corticotropin-Releasing Hormone mRNA in Maternal Plasma: Relationship with Gestational Age and Severity of Preeclampsia Clin. Chem., October 1, 2004; 50(10): 1851 - 1854. [Full Text] [PDF] |
||||
![]() |
Y M D. LO and R. W.K. CHIU The Biology and Diagnostic Applications of Plasma RNA Ann. N.Y. Acad. Sci., June 1, 2004; 1022(1): 135 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. K.O. Ng, A. El-Sheikhah, R. W.K. Chiu, K.C. A. Chan, M. Hogg, R. Bindra, T. N. Leung, T. K. Lau, K. H. Nicolaides, and Y.M. D. Lo Evaluation of Human Chorionic Gonadotropin {beta}-Subunit mRNA Concentrations in Maternal Serum in Aneuploid Pregnancies: A Feasibility Study Clin. Chem., June 1, 2004; 50(6): 1055 - 1057. [Full Text] [PDF] |
||||
![]() |
N B Y Tsui, S S C Chim, R W K Chiu, T K Lau, E K O Ng, T N Leung, Y K Tong, K C A Chan, and Y M D Lo Systematic micro-array based identification of placental mRNA in maternal plasma: towards non-invasive prenatal gene expression profiling J. Med. Genet., June 1, 2004; 41(6): 461 - 467. [Full Text] [PDF] |
||||
![]() |
T. Wataganara, E. S. LeShane, A. Y. Chen, L. Borgatta, I. Peter, K. L. Johnson, and D. W. Bianchi Plasma {gamma}-Globin Gene Expression Suggests that Fetal Hematopoietic Cells Contribute to the Pool of Circulating Cell-Free Fetal Nucleic Acids during Pregnancy Clin. Chem., April 1, 2004; 50(4): 689 - 693. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Rainer, N. Y.L. Lam, N. B.Y. Tsui, E. K.O. Ng, R. W.K. Chiu, G. M. Joynt, and Y.M. D. Lo Effects of Filtration on Glyceraldehyde-3-Phosphate Dehydrogenase mRNA in the Plasma of Trauma Patients and Healthy Individuals Clin. Chem., January 1, 2004; 50(1): 206 - 208. [Full Text] [PDF] |
||||
![]() |
N. Y.L. Lam, T. H. Rainer, R. W.K. Chiu, G. M. Joynt, and Y.M. D. Lo Plasma Mitochondrial DNA Concentrations after Trauma Clin. Chem., January 1, 2004; 50(1): 213 - 216. [Full Text] [PDF] |
||||
![]() |
C. B.M. Oudejans, A. T.J.J. Go, A. Visser, M. A.M. Mulders, B. A. Westerman, M. A. Blankenstein, and J. M.G. van Vugt Detection of Chromosome 21-encoded mRNA of Placental Origin in Maternal Plasma Clin. Chem., September 1, 2003; 49(9): 1445 - 1449. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |