Clinical Chemistry AACC Online Job Center
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 50: 206-208, 2004; 10.1373/clinchem.2003.022533
This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Submit an electronic Letter to
the Editor about this paper
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rainer, T. H.
Right arrow Articles by Lo, Y.M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rainer, T. H.
Right arrow Articles by Lo, Y.M. D.
Related Collections
Right arrow Molecular Diagnostics and Genetics
(Clinical Chemistry. 2004;50:206-208.)
© 2004 American Association for Clinical Chemistry, Inc.


Technical Briefs

Effects of Filtration on Glyceraldehyde-3-Phosphate Dehydrogenase mRNA in the Plasma of Trauma Patients and Healthy Individuals

Timothy H. Rainer1, Nicole Y.L. Lam1, Nancy B.Y. Tsui2, Enders K.O. Ng2, Rossa W.K. Chiu2, Gavin M. Joynt3 and Y.M. Dennis Lo2

1 Accident & Emergency Medicine Academic Unit,
2 Department of Chemical Pathology, and
3 Department of Anaesthesia and Intensive Care, The Chinese University of Hong Kong, Prince of Wales Hospital, Shatin, New Territories, Hong Kong SAR

address correspondence to this author at: Department of Chemical Pathology, The Chinese University of Hong Kong, Prince of Wales Hospital, Room 38023, 1/F Clinical Sciences Bldg., 30-32 Ngan Shing St., Shatin, New Territories, Hong Kong SAR; fax 852-2194-6171, e-mail loym{at}cuhk.edu.hk

The biology and role of circulating cell-free nucleic acids in the diagnosis and risk stratification of many critical diseases attracted much interest in the late 1990s (1). Although plasma DNA took early center stage in disease diagnosis, monitoring and risk stratification for many conditions, including pregnancy (2), cancer(3), transplantation(4), and trauma (5)(6), recent publications suggest that the next stage of development of this field may involve plasma RNA (7)(8)(9).

Cell-free RNA exists in small quantities in the plasma of healthy individuals, and qualitative and quantitative studies have demonstrated increased plasma and serum concentrations of tumor-derived RNA in cancer patients (10)(11)(12). Although we have reported that plasma DNA increases in patients early after trauma, correlates with injury severity, and predicts mortality and other posttraumatic complications (5)(6), there are no published studies investigating circulating mRNA in patients after trauma. Unlike nuclear DNA, cellular mRNA is present in much larger copy numbers, exists normally in the cytoplasm and ribosomes of cells, and may therefore be released earlier than nuclear DNA after trauma.

In this study, we investigated whether mRNA was detectable in plasma of trauma patients, whether concentrations correlated with injury severity and posttraumatic complications, and whether filtration might have an effect on the diagnostic interpretation of the results.

The study was approved by the Ethics Committee of The Chinese University of Hong Kong. Twenty-six trauma patients [mean (SD) age, 46 (18) years; 23 males] admitted to the resuscitation room of the Accident and Emergency Department of the Prince of Wales Hospital were recruited with informed consent. Using a well-established injury severity score (ISS) (13), we divided patients into four groups: minor injury (ISS <9), moderate injury (ISS = 9–15), severe injury (ISS >15), and major complication (mortality or multiple organ dysfunction syndrome; MODS). Fifteen healthy age- and sex-matched controls were also recruited. Peripheral blood was withdrawn into EDTA tubes and centrifuged at 1600g for 10 min at 4 °C. Median time from injury to sampling for the groups with minor, moderate, or severe injuries and the mortality group was 60, 100, 100, and 180 min, respectively (Kruskal–Wallis test, P = 0.28).

Two studies were devised. In study 1, each plasma sample was divided into two aliquots: one aliquot was filtered through a 0.22 µm pore size filter (Millex-GV; Millipore); the other was not subjected to filtration. In study 2, filtered and nonfiltered samples were obtained.

RNA was extracted from 600 µL of plasma with an RNeasy Mini Kit (Qiagen) as described previously, with a final elution volume of 15 µL. The elution volume of 15 µL was as efficient as the 30-µL elution volume suggested by the manufacturer (our unpublished data).

One-step real-time quantitative reverse transcription-PCR was used for measuring mRNA concentrations in plasma, according to previously reported experimental methods (7). In this system, the rTth DNA polymerase functioned both as a reverse transcriptase and a DNA polymerase. The amplification primers were GAPDHF (5'-GAAGGTGAAGGTCGGAGT-3') and GAPDHR (5'-GAAGATGGTGATGGGATTTC-3'), and the dual-labeled fluorescent probe was GAPDHP [5'-(FAM)CAAGCTTCCCGTTCTCAGCC(TAMRA)-3', where FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine]. The intraassay CV at 101 ng/L glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was 25%. The lowest detection limit of the reverse transcription-PCR system was sufficient to detect 0.3 ng/L GAPDH. Plasma DNA was quantified by a real-time quantitative PCR system for the ß-globin gene as described previously (14).

Nonparametric statistical tests, i.e., the Mann–Whitney and Kruskal–Wallis tests, were used to compare groups. The Spearman rank test was used for correlation analysis. The Wilcoxon rank test was used to compare paired continuous values. Dunn’s method, a pairwise multiple comparison test, was used to identify pairs of groups that were significantly different. Statistical analysis was performed with Statview, Ver. 6.0, Statistical Analysis Software (SAS Institute).

In study 1, the effect of filtration and nonfiltration on plasma GAPDH RNA in trauma patients and healthy controls was investigated. (Figures are available in the Data Supplement accompanying the online version of this Technical Brief athttp://www.clinchem.org/content/vol50/issue1/.) All but one patient demonstrated a clear decrease in GAPDH mRNA concentrations after filtration. The median GAPDH concentration in the nonfiltered plasma samples from trauma patients (2387 ng/L; interquartile range, 273-5528 ng/L; data not presented graphically) was increased 53-fold compared with the median GAPDH mRNA concentration in filtered plasma (45 ng/L; interquartile range, 22–106 ng/L) from blood collected at the same time from the same patients (Wilcoxon rank test, P <0.02).

The median mRNA plasma concentration in nonfiltered samples from healthy controls (1401 ng/L; interquartile range, 486-2447 ng/L; data not presented graphically) was increased 280-fold compared with the median mRNA concentration (5 ng/L; interquartile range, 1–12 ng/L) in filtered plasma from blood withdrawn at the same time from the same individuals (P = 0.0077). When analyzed individually, all participants demonstrated a clear decrease in GAPDH mRNA after filtration, although the decrease was less marked in one case.

In study 2, the effect of plasma filtration on circulating plasma GAPDH mRNA and its association with injury severity and posttraumatic complications was investigated. Aliquots from each sample were either filtered individually through 0.22 µm pore size filters before quantitative analysis (n = 18) or left unfiltered (n = 16). No obvious difference in GAPDH concentrations was observed in nonfiltered samples between healthy controls (n = 14); patients with minor (n = 4), moderate (n = 4), or severe injuries (n = 5); patients who died (n = 3; Fig. 1A ; Kruskal–Wallis test, P = 0.69); or with patients who developed MODS (n = 2; Kruskal–Wallis test, P = 0.34; data not shown).



View larger version (12K):
[in this window]
[in a new window]
 
Figure 1. GAPDH mRNA concentrations in nonfiltered (A) and filtered (B) plasma from healthy controls and four groups of trauma patients.

(A), healthy individuals; patients with minor (n = 4), moderate (n = 4), or severe (n = 5) injuries; and patients who died (n = 3) are shown on the x axis. Plasma GAPDH mRNA concentrations are plotted on the y axis in a log10 scale. The lines inside the boxes denote the medians, the boxes indicate the interval between the 25th and 75th percentiles, and the whiskers denote the interval between the 10th and 90th percentiles. The P value for differences among the groups is 0.69 (Kruskal–Wallis test). (B) healthy individuals; patients with minor (n = 7), moderate (n = 5), or severe (n = 4) injuries; and patients who died (n = 2) are shown on the x axis. The plasma GAPDH mRNA concentration is plotted on the y axis in a log10 scale. The lines inside the boxes denote the medians, the boxes indicate the interval between the 25th and 75th percentiles, and the whiskers denote the interval between the 10th and 90th percentiles. The P value for differences among the groups is 0.0008 (Kruskal–Wallis test). When we used Dunn’s method, we found significant differences between the moderate injury and control groups and between the mortality and control groups.

After filtration of plasma samples, a clear pattern was obvious between the median GAPDH concentrations in healthy controls (n = 15) and patients with minor (n = 7), moderate (n = 5), or severe injuries (n = 4) and patients who died (n = 2; Fig. 1BUp ; Kruskal–Wallis test, P = 0.0008). Compared with healthy controls (median, 2.5 ng/L), the median filtered plasma GAPDH concentration was increased 7-fold in the minor injury group (18 ng/L), 17-fold in the moderate injury group (44 ng/L), 12-fold in the severe injury group (31 ng/L), and 72-fold in the group of severely injured patients who did not survive (179 ng/L). We noted significant differences between the moderate injury and control groups as well as between the nonsurvivors and the control group (Dunn’s method, P <0.05). The median filtered plasma GAPDH concentration was also increased sevenfold in patients who died (180 ng/L) compared with the median value in patients who survived (27 ng/L; data not shown; P = 0.0246). The median filtered plasma mRNA concentration was also increased 35-fold in patients who developed MODS (88 ng/L) compared with the median value in healthy controls (2.5 ng/L; data not shown; P = 0.0369).

There was also an association between the median filtered plasma mRNA concentrations and increasing injury severity (Kruskal–Wallis test, P = 0.0015). In addition, there was also a negative correlation between filtered plasma GAPDH concentrations and Glasgow Coma Score (r = -0.602; P = 0.009) and between filtered plasma mRNA concentrations and revised trauma score (r = -0.843; P <0.0001).

A substantial proportion of circulating GAPDH mRNA is associated with particles between the sizes of 0.45 and 0.22 µm (7). The particle-associated nature of plasma mRNA species detectable in trauma patients may not be surprising in view of previous reports that plasma contains much cellular debris (15)(16). However, it is surprising to find that there is a lack of correlation between total plasma mRNA and injury severity and that a clear correlation is revealed by filtration.

The present data indicate that the way in which plasma is obtained should be taken into account in future studies of circulating mRNA in general and trauma in particular. The strong correlation between filtered plasma GAPDH mRNA concentrations and ß-globin DNA concentrations (r = 0.797; P <0.0001) suggests that both of these nucleic acids may come from similar sites of tissue injury. Additional work is required to determine whether plasma mRNA may have a role in posttraumatic risk stratification and disease monitoring.

To our knowledge, this represents the first study of plasma mRNA in trauma patients. Our data clearly demonstrate that because of the particulate nature of plasma mRNA, preanalytical issues have a significant impact on the results. This observation may have general implication for the numerous applications, in fields ranging from cancer detection (17) to noninvasive prenatal diagnosis (8)(9), now envisioned for circulating RNA.


Acknowledgments

This project was supported by a RGC Direct Grant, Project code 2040873.


References

  1. Lo YMD. Circulating nucleic acids in plasma and serum: an overview. Ann N Y Acad Sci 2001;945:1-7.[CrossRef][ISI][Medline] [Order article via Infotrieve]
  2. Lo YMD, Leung TN, Tein MSC, Sargent IL, Zhang J, Lau TK, et al. Quantitative abnormalities of fetal DNA in maternal serum in preeclampsia. Clin Chem 1999;45:184-188.[Abstract/Free Full Text]
  3. Anker P, Lyautey J, Lederrey C, Stroun M. Circulating nucleic acids in plasma or serum. Clin Chim Acta 2001;313:143-146.[CrossRef][ISI][Medline] [Order article via Infotrieve]
  4. Lo YMD, Tein MSC, Pang CC, Yeung CK, Tong KL, Hjelm NM. Presence of donor-specific DNA in plasma of kidney and liver-transplant recipients. Lancet 1998;351:1329-1330.[CrossRef][ISI][Medline] [Order article via Infotrieve]
  5. Lo YMD, Rainer TH, Chan LYS, Hjelm NM, Cocks RA. Plasma DNA as a prognostic marker in trauma patients. Clin Chem 2000;46:319-323.[Abstract/Free Full Text]
  6. Rainer TH. Plasma DNA, prediction and post-traumatic complications. Clin Chim Acta 2001;313:81-85.[CrossRef][ISI][Medline] [Order article via Infotrieve]
  7. Ng EKO, Tsui NBY, Lam NYL, Chiu RWK, Yu SCH, Wong CSC, et al. Presence of filterable and nonfilterable mRNA in the plasma of cancer patients and healthy individuals. Clin Chem 2002;48:1212-1217.[Abstract/Free Full Text]
  8. Ng EKO, Leung TN, Tsui NBY, Lau TK, Panesar NS, Chiu RWK, et al. The concentration of circulating corticotrophin-releasing hormone mRNA in maternal plasma is increased in preeclampsia. Clin Chem 2003;49:727-731.[Abstract/Free Full Text]
  9. Ng EKO, Tsui NBY, Lau TK, Leung TN, Chiu RWK, Panesar NS, et al. Messenger RNA of placental origin is readily detectable in maternal plasma. Proc Natl Acad Sci U S A 2003;100:4748-4753.[Abstract/Free Full Text]
  10. Kopreski MS, Benko FA, Kwak LW, Gocke CD. Detection of tumor messenger RNA in the serum of patients with malignant melanoma. Clin Cancer Res 1999;5:1961-1965.[Abstract/Free Full Text]
  11. Chen XQ, Bonnefoi H, Pelte MF, Lyautey J, Lederrey C, Movarekhi S, et al. Telomerase RNA as a detection marker in the serum of breast cancer patients. Clin Cancer Res 2000;6:3823-3826.[Abstract/Free Full Text]
  12. Dasi F, Lledo S, Garcia-Granero E, Ripoll R, Marugan M, Tormo M, et al. Real-time quantification in plasma of human telomerase reverse transcriptase (hTERT) mRNA: a simple blood test to monitor disease in cancer patients. Lab Invest 2001;81:767-769.[ISI][Medline] [Order article via Infotrieve]
  13. Baker SP, O’Neill B, Haddon W, Long WB. The injury severity score: a method for describing patients with multiple injuries and evaluating emergency care. J Trauma 1974;14:187-196.[ISI][Medline] [Order article via Infotrieve]
  14. Lo YMD, Tein MSC, Lau TK, Haines CJ, Leung TN, Poon PMK, et al. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet 1998;62:768-775.[CrossRef][ISI][Medline] [Order article via Infotrieve]
  15. Poon LL, Leung T, Lau T, Lo YMD. Prenatal detection of fetal Down’s syndrome from maternal plasma. Lancet 2000;356:1819-1820.[CrossRef][ISI][Medline] [Order article via Infotrieve]
  16. van Wijk IJ, de Hoon AC, Jurhawan R, Tjoa ML, Griffioen S, Mulders MA, et al. Detection of apoptotic fetal cells in plasma of pregnant women. Clin Chem 2000;46:729-731.[Free Full Text]
  17. Anker P, Stroun M. Progress in the knowledge of circulating nucleic acids: plasma RNA is particle-associated. Can it become a general detection marker for a cancer blood test?. Clin Chem 2002;48:1210-1211.[Free Full Text]




This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Submit an electronic Letter to
the Editor about this paper
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (5)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rainer, T. H.
Right arrow Articles by Lo, Y.M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rainer, T. H.
Right arrow Articles by Lo, Y.M. D.
Related Collections
Right arrow Molecular Diagnostics and Genetics


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS