| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Technical Briefs |
1 Laboratoire de Virologie Moléculaire et Structurale, Faculté de Médecine, Université Joseph Fourier, Grenoble, France;
2 Département de Virologie Centre Hospitalier Universitaire, Grenoble, France;
aaddress correspondence to this author at: Laboratoire de Virologie Moléculaire et Structurale, Faculté de Médecine, Université Joseph Fourier, BP 53, 38041 Grenoble, France; fax 33-476548074, e-mail raphaele.germi{at}ujf-grenoble.fr
Quantification of the Epstein–Barr (EBV) DNA genome by quantitative real-time PCR has been useful for the management of EBV-associated diseases (1)(2)(3)(4). Nevertheless, it gives no information on the various patterns of expression of the latent genes or on the presence of a lytic infection. EBV lytic mRNAs have been detected in infectious mononucleosis and some EBV-associated malignancies, but their relevance is still debated (5)(6)(7). The quantification of late EBV transcripts may bring additional information to EBV DNA quantification for the understanding and follow-up of EBV-associated disease, as already demonstrated for other herpes viruses (8)(9)(10)(11).
In this study, we developed a method for quantifying a late transcript of the highly conserved EBV envelope glycoprotein gene, gp350/220 (12)(13), that uses real-time reverse transcription-PCR (RT-PCR), the Taqman® technology, and serial dilutions of in vitro transcripts to quantify mRNA. gp350/220 mRNA was quantified in EBV-infected cell lines and was then applied to a series of clinical samples.
Total RNA from cell lines (500 000 cells), clinical samples, or in vitro transcripts (5 µL) was extracted with the High-Pure-RNA-Isolation-Kit® (Roche), and residual DNA was removed by two 20-min incubations with DNase I. The RNA concentration was estimated spectrophotometrically and converted to copy number for the in vitro transcript.
The RT-PCR mixture (20 µL) contained 100 ng of total RNA from cell lines or 250 ng of total RNA from clinical samples, 3.25 mM manganese acetate (LightCycler-RNA-Master-Hybridization-Probes-Kit®; Roche), 0.3 µM upstream primer [gpU2; 5'-AGAATCTGGGCTGGGACGTT-3'; position 89585 (14)], 0.3 µM downstream primer (gpL2; 5'-ACATGGAGCCCGGACAAGT-3'; position 89784), and 0.3 µM probe [EBVGPq; 5'-(6-FAM)AGCCCACCACAGATTACGGCGGT(TAMRA)(Phosphate)-3', where 6-FAM is 6-carboxyfluorescein and TAMRA is 6-carboxytetramethylrhodamine; position 89761]. The RT-PCR program (61 °C for 30 min, 3 min at 95 °C, and 40 cycles of 10 s at 95 °C, and 90 s at 60 °C), produced an amplified fragment of 200 bp.
Absolute quantification was performed with an external RNA calibration curve. The RNA calibrator was obtained by in vitro transcription of 1 µg of a constructed plasmid for 2 h at 37 °C (SP6/T7-Transcription-Kit®; Roche). The plasmid was obtained by cloning in pSPT18 the 200-bp gpU2/gpL2 RT-PCR product, obtained from B95-8 cell line RNA. Serial dilutions of the RNA calibrator were analyzed by real-time RT-PCR, and a wide linear range (50 to 5 x 106 copies) was obtained, indicating the efficiency of the amplification and the sensitivity of the method.
The amplification efficiency in gp350/220-negative samples was controlled by real-time RT-PCR of a reference gene using LightCycler-h-PBGD-Housekeeping-Gene-Set® (Roche). The specificity of the method was confirmed by use of EBV-negative BJAB cells and cells infected by five other herpesvirus strains. A PCR without the reverse transcription step confirmed the absence of DNA contamination.
We evaluated the intraassay repeatability of the method by quantifying in the same assay three aliquots of the calibrators and three aliquots of three biopsy specimens. The CV of the calculated log concentrations ranged from 0.18% to 4.2%. We assessed the interassay reproducibility by quantifying three other aliquots of the same biopsy extracts in three separate runs and five aliquots of the calibrators in five independent assays. The CV ranged from 0.68% to 3.8% (see the Data Supplement that accompanies the online version of this Technical Brief at http://www.clinchem.org/content/vol50/issue10/).
gp350/220 mRNAs was quantified in the EBV-infected cell lines P3HR1, B95-8, and Akata. The P3HR1 and B95-8 B-cell lines spontaneously release viral particles. Moreover, the EBV lytic cycle can be superinduced by treatment with 30 µg/L 12-tetradecanoylphorbol 13-acetate and 3 mmol/L sodium butyrate. The nonproducing Akata cell line was induced by anti-IgG (0.5% by volume; Dako) (15) to release virions.
These cell lines were tested for mRNA production to evaluate the ability of real-time RT-PCR to quantify a change in gp350/220 transcription rate (Fig. 1
) at basal conditions, after lytic cycle enhancement, and after treatment by the 
-amanitin RNA polymerase transcription inhibitor (16)(17)(18). Basal production of gp350/220 mRNA was much higher in B95-8 than in P3HR1 cells. mRNA production in Akata cells was below the detection threshold of the method. Stimulation of viral replication increased gp350/220 mRNA production in all three cell lines (
log copies/µg total RNA = 0.4, 1.2, and 8.2 for B95-8, P3HR1, and Akata cells, respectively). Treatment by -amanitin inhibited gp350/220 mRNA transcription by 96% for B95-8 cells, by 87% for P3HR1 cells, and by 72% for stimulated Akata cells. Cell viability after treatments was tested by Trypan blue staining and was found not to be affected. Thus, quantification of late mRNAs in infected cells could be useful to demonstrate EBV productive replication because this method is more sensitive than previous methods based on the detection of linear EBV genome by tedious Southern blotting strategies (19)(20). This real-time RT-PCR method could also be used for the in vitro evaluation of anti-herpesvirus agents in infected cells (21).
|
This method for quantification of gp350/220 and the EBV DNA quantification method described previously (22) were then applied to 38 clinical samples (Table 1
): 18 peripheral blood mononuclear cell (PBMC) samples isolated by Ficoll-Hypaque density gradient centrifugation and 20 biopsy samples collected either at the time of diagnosis or during the patient’s follow-up.
|
All PBMCs from healthy individuals (10) were negative for mRNAs, as expected because EBV is mainly latent in resting B lymphocytes from seropositive individuals. PBMCs from four patients (two adults and two children) presenting with posttransplantation lymphoproliferative disorders [PTLD(+)] and four transplanted children with asymptomatic primary EBV infection [PTLD(–)] were also analyzed. The PBMCs from all four PTLD(–) children had a higher mRNA load than DNA load. On the other hand, in the PBMCs of PTLD(+) patients, the mRNA load was lower than the DNA load. Furthermore, the biopsies of four other PTLD(+) patients (again two adults and two children) also had lower mRNA loads than DNA loads. Thus, the quantification of late mRNAs along with EBV DNA load measurement could help to better differentiate patients with or without PTLD. In addition, the detection of mRNAs in three of four PBMC and four of four biopsy samples from PTLD(+) patients correlates with a recent study in which gp350/220 mRNA was not detected in healthy control PBMCs but was observed in 50% and 100% of PBMCs and biopsies, respectively, from patients with PTLD (6). Nevertheless, the authors of that study, performed with a qualitative analysis, concluded that late mRNA detection had no predictive value concerning the possible evolution to PTLD. This discrepancy is probably attributable to the quantitative aspect and more sensitive mRNA analysis allowed by our real-time RT-PCR strategy. Furthermore, although the presence and signification of late mRNAs during PTLD are still controversial, the detection of these late mRNAs in biopsies and PBMCs could account for the regression of PTLD after antiviral treatment, as was also indicated by the detection of EBV immediate-early ZEBRA mRNAs (23)(24)(25).
Interestingly, the biopsies of patients with fatal infectious mononucleosis associated with a hemophagocytic syndrome showed a profile of gp350/220 mRNA production similar to that in PTLD (higher DNA than mRNA load). Hemophagocytic syndrome is characterized by monoclonal or oligoclonal proliferation of EBV-infected T cells. It is tempting to suggest that a lytic cycle could occur in vivo within EBV-infected T cells. Nevertheless, another study, using qualitative RT-PCR, did not detect lytic gene expression in biopsies or PBMCs from patients presenting with a hemophagocytic syndrome (26). These results and their interpretation require further evaluation.
Our study also demonstrated the presence of gp350/220 mRNAs in three of five nasopharyngeal carcinoma biopsies, as demonstrated previously by Martel-Renoir et al. (27) who found gp220 mRNA in two of eight biopsies, although all of them were positive for immediate-early transcripts. Another study using qualitative RT-PCR detected late major-capsid transcripts in five of seven nasopharyngeal carcinomas but also in three of five normal nasopharyngeal biopsies (5). It should be noted that gp350/220 and major-capsid transcripts have also been detected recently in biopsies of EBV-positive gastric carcinoma cases (7).
Finally, no gp350/220 mRNA was detected in the eight biopsies from patients with Hodgkin disease. This correlates with a previous study that detected gp350/220 mRNA by RT-PCR in only 1 of 10 biopsies, whereas the immediate-early protein ZEBRA was detected in Reed-Sternberg cells in 3 of 40 biopsies of Hodgkin disease, confirming that viral replication in EBV-associated Hodgkin disease is a rare event (19)(28).
In conclusion, we have developed a simple and accurate technique to quantify gp350/220 mRNA in cell cultures and in clinical samples. Late EBV mRNAs are present in the last stages of EBV productive replication. Thus, this method could be useful to assess a productive infection in vitro or in vivo. Interestingly, this method demonstrated various patterns of gp350/220 mRNA production in EBV-associated malignancies. More systematic studies in clinical specimens should be carried out with real-time RT-PCR to quantify the gp350/220 and other EBV late mRNAs and to reexamine the pattern of late gene expression in EBV-associated diseases.
Acknowledgments
We are grateful to Pierre-Emmanuel Colle for reviewing this manuscript. This work was supported by grants from the "Agence Nationale de Recherche sur le Sida" (ANRS), the University Joseph Fourier, and the University Hospital of Grenoble.
Footnotes
1 these authors contributed equally to this study; 
References
-amanitin. Nucleic Acids Res 1996;24:2924-2929.
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or after 48-h inhibition of cellular transcription by 
).
), and anti-IgG stimulated Akata cells (