| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Technical Briefs |
1 Department of Clinical and Experimental Medicine, Division of Microbiology, University of Bologna, Bologna, Italy
aaddress correspondence to this author at: Department of Clinical and Experimental Medicine, Division of Microbiology, University of Bologna, Via Massarenti 9, I-40138 Bologna, Italy; fax 39-051-341632, e-mail ggalline{at}med.unibo.it
Parvovirus B19, a pathogenic virus widely distributed in the human population, is responsible for various pathologies and diverse clinical manifestations (1). Diagnosis by detection of virus and quantitative evaluation of viral load is important mainly at the onset of infections before an immune response develops, in cases of atypical immune response, in the course of chronic infections, and in the occurrence of fetal infections (2). In the acute phase of infections, virus can be present in the blood at concentrations >1015 virions/L, posing a risk of transmission through transfusions and therapeutic use of blood products. Quantitative evaluation of B19 virus contamination of plasma pools for the production of blood derivatives is required as a measure to reduce the risk of transmission of infections (3).
Fluorescence-based real-time PCR assays can combine specific detection and quantitative evaluation of the viral load. For quantitative evaluation of the viral load, real-time PCR assays must be carefully designed to give reliable results. In particular, the mode of quantification, whether absolute or relative, and an appropriate calibration method need to be firmly established (4)(5). Absolute quantification can be obtained by referring to a calibration curve. To take into account the variability attributable to cumulating effects both in sample processing and in the analytical phases, the calculated amount of target nucleic acids can be normalized to the calculated amount of a reference target that is likely to be present in constant amounts in all samples analyzed. Alternatively, relative quantification can be obtained from the ratio of target present in experimental samples to target in a calibrator sample. To compensate for sample variability, ratios can be further normalized with respect to a parallel, relative quantification of a reference target (6).
Different real-time PCR assays for the detection of B19 virus in clinical samples have been developed and described. These include use of the LightCycler system and detection by use of Sybr Green (7) or fluorescence resonance energy transfer probes (8), as well as by use of the ABI Prism system and detection by TaqMan probes (9)(10). In our work, we developed a calibrated real-time PCR assay that uses the LightCycler system for the detection and quantitative evaluation of B19 virus nucleic acids. B19 virus target in experimental samples was quantified relative to a calibrator sample containing a known amount of viral target. An exogenous nucleic acid was designed as an analytical standard for monitoring sample processing and amplification and as a reference target to normalize quantification.
For the proposed real-time PCR assay, we constructed two plasmids. Plasmid pHR0 contains a 4900-bp viral segment, corresponding to nucleotides 346-5245 of the B19 virus genome (National Center for Biotechnology Information Genome Database NC_000883), inserted in plasmid vector pGEM3Z (Promega). Plasmid pEC01 contains a 192-bp synthetic segment, designed as a unique sequence unrelated to known sequences present in the National Center for Biotechnology Information nucleotide database (5'-ttttcttgttatttctcctgctacttgtcgtggtagttatcatgataacctcgtcatcttccccgccacctcccgcggcagctgccacgacaactaggtgatgttgctggcgacgtcgccggggaggtggcgggagaagtagcaaatattactagtaacatcaccagcaagatgacgaggaaaataacaaga-3'), inserted in plasmid vector pTRI19amp (Ambion). Both viral (HR0) and reference (EC01) target DNA were produced as linear amplification products from template plasmid DNA and used as genome equivalents (geq) standards in the following amplification reactions. Specific primer pairs were designed for the real-time PCR assay that were optimal in terms of specificity, sensitivity, and efficiency of amplification (see Table 1
in the Data Supplement that accompanies the online version of this Technical Brief at http://www.clinchem.org/content/vol50/issue4/).
|
Real-time PCR was performed with the LightCycler system and Sybr Green detection of amplification products (see Table 2 in the online Data Supplement). For evaluation of the real-time PCR assay, fluorescence emission was analyzed for target quantification and melting curve profiles. Analysis of the amplicon accumulation curves by use of the fit-point method yielded, for each reaction, crossing point (Cp) numbers that were related to the log of target copy number with the function present into the software. Analysis of the melting curve profiles confirmed specific accumulation of the amplification products, with a single melting peak for the viral target [melting temperature (Tm) = 82.6–82.8 °C] and a double melting peak for the reference target (Tm1 = 79.6–79.8 °C; Tm2 = 85.8–86.2 °C). Specific amplification of the viral and reference targets was further confirmed by sequencing of amplification products.
The characteristics of the assay have been evaluated according to guidelines for the validation of analytical procedures (11). Serial dilutions of HR0 or EC01 target sequences, from 10-1 to 108 geq/reaction, were amplified in triplicate series repeated three times in different experimental sessions. Calibration curves were constructed by plotting Cp values as a function of log of target copy number. For both the viral and reference targets, the calibration curves obtained were linear in the range 102–108 geq. The detection limit, determined by endpoint dilution analysis, was 101 geq. Considering the linear range interval, these curves showed high correlation, accuracy, and precision as reported (see Table 3 in the online Data Supplement). The efficiencies of the two amplification reactions were calculated from the slopes of linear regression curves following the relationship: E = 10(-1/slope) and were 1.872 for HR0 and 1.638 for EC01.
In the following experiments, the viral target in experimental samples was quantified relative to a calibrator sample and normalized to the reference target. Quantification was obtained by applying the relationship (6): Ratio = Etarget
Cptarget(control - sample)/ErefCpref(control - sample). Etarget and Eref are the efficiencies of the amplification reactions for viral and reference targets as determined previously, and Cptarget and Cpref are the deviations in respective Cp values, obtained in parallel amplification reactions, between a control sample, used as calibrator and the sample analyzed. Absolute quantification of the viral target was then obtained by multiplying for the known amount of viral target present in the calibrator.
The characteristics of this model for quantification were first evaluated by amplifying serial dilutions of HR0 target sequences, from 10-1 to 108 geq/reaction, in the presence of 103 geq of EC01 target sequences in triplicate series repeated three times in different experimental sessions. Samples were separately amplified with the specific primer pairs, and Cp values were obtained for both viral and reference targets. The mean standard deviation (and its SD) for the grouped Cp values for the viral target in the range 102–108 geq was 0.47 (0.19); the mean (SD) standard deviation for the Cp values for the reference target at 103 geq was 0.20 (0.09). We therefore applied the above-indicated relationship, considering as calibrator each sample in turn, and performed regression analysis on log-transformed data to correlate the obtained experimental values with the expected values. Quantification of the viral target normalized with respect to the reference target led to experimental values in good agreement with expected values, independent of the sample used as calibrator (Table 1
and Fig. 1
).
|
For the analysis and quantitative evaluation of B19 viral load in serum and plasma specimens, the International Standard for B19 DNA (NIBSC 99/800; 109 IU/L) was used as the standard sample (12). Serial dilutions of the International Standard, containing 105 to 108 IU/L, were processed in the presence of 107 geq/L EC01 DNA by a lysis and precipitation procedure (see the Note in the online Data Supplement), and duplicate samples were amplified separately with the specific primer pairs for both viral and reference targets. When we considered as calibrator any dilution of the International Standard processed together with EC01 reference target DNA, relative quantification yielded experimental values, directly expressed as IU/L, that showed linearity with expected values in the detection interval from 106 to 108 IU/L. The mean (SD) values for the parameters obtained by regression analysis on log-transformed data were as follows: slope = 1.001 (0.038); r2 = 0.863; SD of the residuals = 0.176.
The experimental procedure and the analytical model were therefore applied in two different situations in which determination of B19 viral load is especially relevant: clinical evaluation in the course of prolonged viremia, and prevention of transmission of the virus.
Serum samples were obtained consecutively during a 12- to 16-month period from three different individuals with documented persistent B19 virus in the peripheral blood associated with clinical symptoms typical of B19 virus infection, such as recurrent cutaneous rash and arthropathies. As control, the International Standard at the dilution of 108 IU/L was used. All sera and controls were processed in the presence of 107 geq/L EC01 DNA. All samples were then analyzed by real-time PCR for quantification of the viral target and normalized to the reference target. Viral load values obtained by quantitative real-time PCR indicated persistence of the virus in the peripheral blood of these individuals at significant concentrations for extended periods of time (see Fig. 1 in the online Data Supplement).
We also analyzed 16 plasma pool samples, each derived from 960 single donations and representative of manufacturing plasma pools for the production of blood derivatives (obtained from Kedrion Biopharmaceuticals, Bolognana, Lucca, Italy), using as control the International Standard at 108 IU/L. All samples and controls were processed and analyzed as described, and viral loads were obtained (see Fig. 2 in the online Data Supplement). In plasma pools for the production of blood derivatives, quantitative evaluation of the viral load is required as a manufacturing standard to reduce the risk of transmission of virus, and a threshold considered acceptable for contamination has been set at 107 geq/L (3). B19 virus can be present in the blood at very high concentrations, and because of the frequency of viremic individuals in a donor population, contaminated blood might be inadvertently included in the manufacturing of plasma pools (13), leading to measurable contamination of the final blood products (14). Of the 16 plasma pools, only 2 did not have detectable B19 virus, whereas 4 had viral loads higher than the threshold limit of 107 IU/L.
In this study, we obtained quantitative results by use of a mathematical model that quantified the viral target present in experimental samples with respect to a calibrator sample. A synthetic nucleic acid added in defined amounts to the sample at the start of the analytical process was appropriate both as an analytical standard and as a reference target for normalization of relative amounts. Because in our protocol the calibrator sample contained known amounts of viral and reference target sequences, the relative value could be converted to an absolute value for target viral load in the samples.
Acknowledgments
This work was supported by funds from Ministero dell’Istruzione, dell’Università e della Ricerca and from the University of Bologna. The LightCycler instrument was made available by Centro Interdipartimentale Ricerche Biotecnologiche, University of Bologna.
References
The following articles in journals at HighWire Press have cited this article:
|
|
 |
|
  L. Pironi, F. Bonvicini, P. Gionchetti, A. D'Errico, F. Rizzello, C. Corsini, L. Foroni, and G. Gallinella Parvovirus B19 Infection Localized in the Intestinal Mucosa and Associated with Severe Inflammatory Bowel Disease J. Clin. Microbiol., May 1, 2009; 47(5): 1591 - 1595. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Tassinari, G. Gallinella, N. C Salfi, D. Elleri, S. Forti, F. Bonvicini, and F. Bernardi Gastrointestinal lesions in parvovirus B19 infection BMJ Case Reports, March 17, 2009; 2009(mar08_1): bcr1020081058 - bcr1020081058. [Abstract] [Full Text]
|
|
|
|
 |
|
 F. Bonvicini, C. Filippone, E. Manaresi, M. Zerbini, M. Musiani, and G. Gallinella HepG2 hepatocellular carcinoma cells are a non-permissive system for B19 virus infection J. Gen. Virol., December 1, 2008; 89(12): 3034 - 3038. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Musiani, E. Manaresi, G. Gallinella, and M. Zerbini Persistent parvovirus b19 infection resulting in carpal tunnel syndrome J. Clin. Pathol., October 1, 2007; 60(10): 1177 - 1178. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
