Clinical Chemistry Siemens Point of Care - Urinalysis
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Clinical Chemistry 51: 224-227, 2005. First published October 28, 2004; 10.1373/clinchem.2004.041228
This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
clinchem.2004.041228v1
51/1/224    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farina, A.
Right arrow Articles by Carinci, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farina, A.
Right arrow Articles by Carinci, P.
Related Collections
Right arrow Molecular Diagnostics and Genetics
(Clinical Chemistry. 2005;51:224-227.)
© 2005 American Association for Clinical Chemistry, Inc.


Technical Briefs

Lower Maternal PLAC1 mRNA in Pregnancies Complicated with Vaginal Bleeding (Threatened Abortion <20 Weeks) and a Surviving Fetus

Antonio Farina1,2,3,a, Nicola Rizzo2, Manuela Concu1, Irina Banzola1, Akihiko Sekizawa3, Silvia Grotti2 and Paolo Carinci1

1 Department of Histology, Embryology and Applied Biology and 2 Division of Prenatal Medicine, University of Bologna, Bologna, Italy 3 Department of Obstetrics and Gynecology, Showa University School of Medicine, Tokyo, Japan

aaddress correspondence to this author at: Via Belmeloro 8, 40126 Bologna Italy; fax 39-51-2094110, e-mail antonio.farina{at}unibo.it

Trophoblastic cells of the placenta enter the maternal circulation and can be isolated there along with their specific mRNAs (1)(2). Increased concentrations of mRNA for corticotropin-releasing hormone, which is synthesized in the placenta, are seen in the blood of patients affected by preeclampsia (3), and panels of mRNAs(4) can be used to test for a disease of interest. The mRNA concentration in blood may vary with intracellular expression and with the number of trophoblastic cells expressing that specific mRNA per unit of blood. We hypothesize that pregnancies affected by a threatened abortion, but with a viable embryo, exhibit lower concentrations of mRNA for the placenta-expressed gene PLAC1 because of possible underlying delayed or abnormal placental growth at the time of maternal blood collection.

We studied 10 pregnant women admitted for a threatened abortion at <20 weeks of gestation (threatened abortion group). The study was approved by our local ethics committee, and all patients gave informed consent. All fetuses with abnormal karyotypes and pregnant women with preeclampsia, pre- or postterm delivery, uterine pathology such as myomas or malformations, placenta abruptio, loss to follow-up, and a vaginal or cervical lesion visualized on clinical examination that could explain the vaginal bleeding were excluded from the study. We also excluded those women who had vaginal bleeding and a subsequent miscarriage because villus destruction, apoptosis, and embryo death could increase the number of circulating placental cells and nucleic acids in the maternal blood, as could abnormal fetal karyotype, fetal malformation, and abnormal maternal immune response. Placental abruption observed later in the pregnancy was also excluded as a possible source of feto-maternal hemorrhage. During hospitalization, all women were maintained at complete bed rest, and routine ultrasound examinations and endocrine (ß-hCG) evaluation were carried out. We also studied 66 normal pregnancies as controls. All blood tests were performed 1–2 days after the first occurrence of bleeding.

Peripheral blood samples (500 µL) were collected in tubes containing EDTA and processed within 1 h. We added an equal volume of 1x Dulbecco’s phosphate-buffered saline (ICN Biochemicals, Inc.) and a double volume of Lysis Reagent (Applied Biosystems) to a final volume of 2 mL. The Lysis Reagent is part of the Starter Kit protocol and is needed to lyse the sample and to protect the free nucleic acids from degradation. The samples were stored at –20 °C until further processing.

We extracted total RNA with the reagents and disposable Starter Kit for the ABI PRISM 6100 Nucleic Acid Prep Station (Applied Biosystems), with a final volume of 100 µL. We included an additional step with Absolute RNA Wash Solution, which is designed to remove contaminating DNA and PCR-inhibitory substances from purified RNA. This solution is able to directly remove background DNA in situ from immobilized RNA on the purification tray during the standard protocol developed by Applied Biosystems. After a brief incubation, subsequent wash steps remove the reagent.

Reverse transcription was performed by use of the High-Capacity cDNA Archive Kit (Applied Biosystems) according to the manufacturer’s protocol. The whole sample of total RNA (50 µL) from peripheral blood was reverse-transcribed in a final volume of 100 µL, containing 10x reverse transcription buffer, 25x deoxynucleotide triphosphates, 10x reverse transcription random primers, and 50 U/µL MultiScribe reverse transcriptase. Incubation in a GenAmp PCR System 9600 thermal cycler was performed in two steps: 10 min at 25 °C, followed by 120 min at 37 °C.

Quantitative real-time PCR analysis was performed by use of a PE Applied Biosystems 5700 Sequence Detection System (Applied Biosystems).

To determine the amount of cDNA, we used the PLAC1 and hPL loci. Every sample was triple tested for each gene in different tubes. The hPL locus was used as a positive control. The primer and probe combinations for PLAC1 (5) and hPL(6) are listed in the Data Supplement that accompanies the online version of this Technical Brief at http://www.clinchem.org/content/vol51/issue1/.

Calibration curves for PLAC1 quantifications used 1 x 107 to 1 x 101 copies of single-stranded synthetic DNA oligonucleotides (Proligo; CELBIO) specifying the PLAC1 amplicon. Concentrations were expressed as cDNA copies/mL. The sequence of the synthetic DNA oligonucleotide for PLAC1 calibration was 5'-GATCCTCCTCACCTCTGCGTTTTCAGCCGGTTCAGGACAAAGTCCAATGACTGTGCTGTGCTCCATAGACTGGT-3'.

A calibration curve for hPL quantification was prepared as described above, with the sequence of the synthetic DNA oligonucleotide being 5'-TGCGGAGCAGCTCTAGATTGGATTTCTGTTGCGTTTCCTCCATGTTGGAGGGTGTCGGAATAGAGTCTGAGAAGCAGAAGGAGGTCTGGGAGTCATGC-3' (6).

For the PCR analysis, 50 µL of reaction volume contained 17.5 µL of cDNA. The reaction mixture contained the amplification primer (400 nM for PLAC1 and 300 nM for hPL), the dual-labeled probe (100 nM for both genes), and the necessary components provided in the TaqMan Universal PCR Master Mix (Applied Biosystems). This corresponded to 1.25 U of AmpliTaq Gold DNA Polymerase; 0.5 U of AmpErase Uracil N-Glycosylase; 200 µM each of dATP, dCTP, and dGTP; 400 µM dUTP; 10x TaqMan Buffer A; and 25 mM MgCl2. Buffer A contains Passive Reference I for signal normalization in all TaqMan reactions. Each sample was analyzed in triplicate, and the means were used for calculations.

The thermal profiles were obtained by use of a 2-min incubation at 50 °C, followed by an initial 10-min denaturation step at 95 °C and by 40 cycles of 1 min each at 56 °C plus 20 s at 95 °C.

The clinical variables and PLAC1 mRNA data are summarized in Table 1 of the online Data Supplement. The data stratified according to estimated amount of bleeding and gestational age at the time of blood collection are shown in Table 1 .


View this table:
[in this window]
[in a new window]
 
Table 1. Data stratified according to bleeding characteristics at the time of blood collection and outcome.

Median (range) PLAC1 mRNA values were 356 (2.42–16 237) copies/mL for the controls and 42 (10.72–281.78) copies/mL for the cases. Five cases with a median gestational age of 65 (49–70) days had much lower PLAC1 values than 23 controls with a median gestational age of 73 (49–75) days (P = 0.002). On the other hand, 5 affected cases with a median gestational age of 121 (105–126) days had a median PLAC1 value very similar to that observed for 43 controls [86 (78–91) days; Fig. 1 ]. This result could be consistent with the role of PLAC1 in early trophoblast development.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 1. PLAC1 mRNA concentration at the time of blood collection.

Box-and-whisker plots of cases and controls are stratified according to two gestational ages (GA). {cjs3656}, outliers. *, P <0.001, Mann–Whitney U-test.

PLAC1 mRNA displayed a wider distribution in controls than in cases. We also stratified the series according to fetus gender because PLAC1 gene maps on the X chromosome (region Xq26) (5)(7). We found no statistical difference for male and female fetuses, even when females showed slightly higher mRNA expression (Table 2 of the online Data Supplement).

As shown in Table 1Up , vaginal bleeding and/or number of previous bleeding episodes did not correlate with PLAC1 concentration. This could be related to the fact that the mRNA concentration is a real-time marker for cellular damage, as has been reported previously for fetal DNA (8).

When vaginal bleeding occurs, some kind of vascular disruption of the maternal-fetal interface resulting from abnormal or delayed placental differentiation may be hypothesized. The vascular injury has been reported to be so minimal that it cannot be detected by Doppler ultrasound (9), but such an event affects the maternal serum concentration of proteins produced by the placenta and the fetus (10)(11). Numerous factors, among them decidualized endometrium and the trophoblast itself, have been implicated in the regulation of extravillous trophoblast maturation. Subsequent development of the placenta depends on the proliferation, migration, and invasion of fetal trophoblast cells into the maternal uterus, by means of a dynamic change in gene expression (12). Interestingly, it is likely that the genes involved in preeclampsia belong to those important for implantation and maintenance of pregnancy, Specific gene products, as well as PLAC1, can provide a useful model to investigate whether some abnormal placental developments can be related to lower mRNA expression. It must be stressed, however, that vaginal bleeding may indicate an underlying placental dysfunction (which might subsequently lead to miscarriage, preeclampsia, fetal growth restriction, or preterm delivery) that manifests later throughout the pregnancy and is associated with higher fetal cells and/or free nucleic acids passage into the maternal circulation, a condition that might affect mRNA quantification. We reduced the risk of this bias by enrolling only those women whose pregnancies had a favorable outcome and who had no clinical complications reasonably able to affect mRNA expression. We included, however, in our series one case of marginal placenta previa not detectable at the time of blood collection (7 weeks of gestation) because we believe that such evidence reinforces the role of the PLAC1 gene in proper placentation and its possible ability to detect, in advance, placental dysfunctions. In fact, even if not completely understood, abnormal trophoblastic infiltration (13) has been proposed as a mechanism for abnormal placement of the placenta. Plac1, a placenta-specific gene of the mouse, should facilitate trophoblastic interactions peculiar to the placenta-uterus interface (14). More recently, Fant et al. (5) examined the cellular location of PLAC1 (the human ortholog of Plac1), and confirmed its placental expression throughout human pregnancy.

Our data are the first clinical evidence of a correlation between mRNA for a trophoblast-specific gene and vaginal bleeding. This evidence is in agreement with all reports describing how such pregnancies are at higher risk of adverse obstetric outcomes, including preeclampsia, intrauterine growth restriction, preterm delivery, or placental abruption, all associated with abnormal placentation that could start at the early stages of pregnancy.

In conclusion, the concentration of mRNA for the PLAC1 gene in maternal blood is lower in cases affected by early vaginal bleeding before 10 weeks of gestation with a viable embryo but not at 15–18 weeks. Such results are indicative of a role of PLAC1 in the regulation of a normal fetal-maternal interface during the early stages of human fetal development.


Acknowledgments

This work was supported by Fondazione CARISBO Progetto triennale—Molecular Genetics of fetal DNA, Italy (Ex 60% to A.F., Ex 60% to P.C.). We thank Brenda Wilmoth Lerner for reviewing the manuscript.


References

  1. Taniguchi R, Koizumi T, Das H, Chakraborty S, Sugimoto T, Hasegawa K, et al. Trophoblastic cells expressing human chorionic gonadotropin genes in peripheral blood of patients with trophoblastic disease. Life Sci 2000;66:1593-1601.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  2. VanWijk IJ, Van Vugt JMG, Konst AAM, Mulders MAM, Florijn WJ, Oudejans CBM. Identification of HASH2-positive extravillous trophoblast cells in the peripheral blood of pregnant women. Trophoblast Res 1998;11:23-33.
  3. Ng EKO, Leung TN, Tsui NBY, Lau TK, Panesar NS, Chiu RWK, et al. The concentration of circulating corticotropin-releasing hormone mRNA in maternal plasma is increased in preeclampsia. Clin Chem 2003;49:727-731.[Abstract/Free Full Text]
  4. Tsui NBY, Chim SSC, Chiu RWK, Lau TK, Ng EKO, Leung TN, et al. Systematic micro-array based identification of placental mRNA in maternal plasma: towards non-invasive prenatal gene expression profiling. J Med Genet 2004;41:461-467.[Free Full Text]
  5. Fant M, Weisoly DL, Cocchia M, Huber R, Khan S, Lunt T, et al. PLAC1, a trophoblast-specific gene, is expressed throughout pregnancy in the human placenta and modulated by keratinocyte growth factor. Mol Reprod Dev 2002;63:430-436.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  6. Ng EK, Tsui NB, Lau TK, Leung TN, Chiu RW, Panesar NS, et al. mRNA of placental origin is readily detectable in maternal plasma. Proc Natl Acad Sci U S A 2003;100:4748-4753.[Abstract/Free Full Text]
  7. Cocchia M, Huber R, Pantano S, Chen EY, Ma P, Forabosco A, et al. PLAC1, an Xq26 gene with placenta-specific expression. Genomics 2000;68:305-312.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  8. Sekizawa A, Jimbo M, Saito H, Iwasaki M, Matsuoka R, Okai T, et al. Cell-free fetal DNA in the plasma of pregnant women with severe fetal growth restriction. Am J Obstet Gynecol 2003;188:480-484.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  9. Alcazar JL, Ruiz-Perez ML. Uteroplacental circulation in patients with first-trimester threatened abortion. Fertil Steril 2000;3:130-135.
  10. Berry E, Aitken DA, Crossley JA, Macri JN, Connor JM. Analysis of maternal serum {alpha}-fetoprotein and free ß human chorionic gonadotrophin in the first trimester: implications for Down syndrome screening. Prenat Diagn 1995;15:555-565.[Web of Science][Medline] [Order article via Infotrieve]
  11. Lockwood GM, Ledger WL, Barlow DH, Groome NP, Muttukrishna S. Measurement of inhibin and activin in early human pregnancy: demonstration of fetoplacental origin and role in prediction of early-pregnancy outcome. Biol Reprod 1997;57:1490-1494.[Abstract]
  12. Handwerger S, Aronow B. Dynamic changes in gene expression during human trophoblast differentiation. Recent Prog Horm Res 2003;58:263-281.[Abstract/Free Full Text]
  13. Biswas R, Sawhney H, Dass R, Saran RK, Vasishta K. Histopathological study of placental bed biopsy in placenta previa. Acta Obstet Gynecol Scand 1999;78:173-179.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  14. Bork P, Sander C. A large domain common to sperm receptors (Zp2 and Zp3) and TGF-ß type III receptor. FEBS Lett 1992;300:237-40.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]



The following articles in journals at HighWire Press have cited this article:


Home page
Clin. Chem.Home page
Y. Purwosunu, A. Sekizawa, K. Koide, A. Farina, N. Wibowo, G. H. Wiknjosastro, S. Okazaki, H. Chiba, and T. Okai
Cell-Free mRNA Concentrations of Plasminogen Activator Inhibitor-1 and Tissue-Type Plasminogen Activator Are Increased in the Plasma of Pregnant Women with Preeclampsia
Clin. Chem., March 1, 2007; 53(3): 399 - 404.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
S Okazaki, A Sekizawa, Y Purwosunu, M Iwasaki, A Farina, and T Okai
Measurement of mRNA of trophoblast-specific genes in cellular and plasma components of maternal blood.
J. Med. Genet., September 1, 2006; 43(9): e47 - e47.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Extract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
clinchem.2004.041228v1
51/1/224    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Farina, A.
Right arrow Articles by Carinci, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Farina, A.
Right arrow Articles by Carinci, P.
Related Collections
Right arrow Molecular Diagnostics and Genetics


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS