| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Technical Briefs |
1 University Women’s Hospital/Department of Research, Basel, Switzerland
aaddress correspondence to this author at: Laboratory for Prenatal Medicine, University Women’s Hospital/Department of Research, Spitalstrasse 21, CH 4031 Basel, Switzerland; fax 41-61-265-9399, e-mail shahn{at}uhbs.ch
Cell-free fetal DNA and fetal mRNA can be found in maternal plasma and used for noninvasive prenatal diagnosis and, potentially, for monitoring and prognosis of certain pregnancy-related clinical conditions (1)(2)(3)(4)(5)(6)(7)(8)(9)(10)(11)(12). The excess of maternal DNA in these samples, however, complicates the detection of fetal genetic traits that are similar to those in the maternal genome (e.g., point mutations) (1)(13)(14). In normal pregnancies, fetal DNA represents only 
3–6% of the total DNA in maternal plasma (15). Thus, technical challenges lie in either developing methods permitting the reliable differentiation of fetal genetic loci or in reducing the amount of circulatory maternal DNA.
Dhallan et al. (16) have recently reported that the addition of formaldehyde to maternal blood samples increases the proportion of cell-free fetal DNA in maternal plasma by decreasing the concentration of maternal DNA. This effect was proposed to reflect an ability of formaldehyde to stabilize the maternal blood cells, thereby preventing the release of DNA from these cells should they die during sample collection and processing.
We have sought to verify this report and have investigated whether the addition of formaldehyde to maternal blood samples does indeed significantly alter the proportion of fetal DNA in maternal plasma samples. We also examined whether such treatment would improve the yield of fetal RNA. The rationale for this additional analysis was provided by the recent observation that circulating fetal hematopoietic cells may contribute to the pool of mRNA molecules in plasma (17) and the view that formaldehyde treatment may inhibit the activity of any ribonucleases in the sample.
We also examined whether the effect mediated by formaldehyde described by Dhallan et al. (16) was specific for the centrifugation conditions that they used or whether this would also be applicable for centrifugation conditions routinely used in our laboratory and in many other institutions (18)(19). These experimental protocols can therefore be summarized as follows:
After obtaining approval from the Cantonal Institutional Review Board of Basel, Switzerland, we collected 18 mL of peripheral blood from pregnant women (n = 26; median gestational age, 15 weeks; range, 11–40 weeks), who had all given written informed consent. All samples were processed within 1 h of venipuncture, and all analyses were performed in a blinded manner. The maternal blood samples were collected in two separate 9-mL EDTA tubes (Sarstedt), one of which was modified as described by Dhallan et al. (16) in that it contained 0.225 mL of a 10% neutral-buffered solution containing formaldehyde (40 g/L; Sigma); the other was not modified. After venipuncture, the contents of each of these two tubes were split into two fractions. One part was examined by protocols A and B, being centrifuged as described by Dhallan et al. (200g for 10 min, 1600g for 10 min, 1600g for 10 min) with brake and acceleration settings set to zero (16). The other two fractions, to be examined by protocols C and D, were centrifuged by our standard protocol (1600g for 10 min at 4 °C and 16 000g for 10 min at room temperature) (18)(19). In each case, DNA was extracted from 400 µL of plasma by use of the High Pure PCR Template Preparation Kit (Roche Diagnostics) and eluted in 100 µL of elution buffer. In a similar manner, total RNA was extracted from 800 µL of plasma as described by Ng et al. (6), with use of an RNeasy mini column (RNeasy Mini Kit; Qiagen) and processed according to the manufacturer’s instructions. RNA was eluted with 30 µL of RNase-free water, aliquoted, and stored at –80 °C. The samples were treated with DNase to remove any contaminating DNA (RNase-Free DNase Set; Qiagen). The concentration and integrity of total RNA were monitored by use of an Agilent 2100 Bioanalyzer (Agilent Technologies) with the RNA 6000 Nano/Pico Lab-on-a-chip reagent set. The RNA 6000 Ladder used was a set of six RNA transcripts with lengths of 0.2, 0.5, 1.0, 2.0, 4.0, and 6.0 kb from Ambion.
Total DNA in the plasma was quantified by a TaqMan® real-time PCR assay (Applied Biosystems) for a chromosome 21-specific sequence (20). The amplification primers were 5'-CCCAGGAAGGAAGTCTGTACCC-3' (forward) and 5'-CCCTTGCTCATTGCGCTG-3' (reverse), and the dual-labeled fluorescent probe was 5'-(FAM)CTGGCTGAGCCATC(MGB)-3', where FAM is 6-carboxyfluorescein and MGB is minor groove binding. Fetal DNA in the sample was quantified by real-time PCR for a Y-chromosome-specific sequence as described previously (5).
Total mRNA in the plasma was quantified by a TaqMan one-step real-time quantitative reverse transcription-PCR (RT-PCR; Applied Biosystems) using a glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific assay. The amplification primers were 5'-CCACATCGCTCAGACACCAT-3' (forward) and 5'-ACCAGGCGCCCAATACG-3' (reverse), and the labeled probe was 5'-(VIC)CCAAATCCGTTGACTCCGACCTTCAC(TAMRA)-3' (VIC is an ABI registered trademark and TAMRA is 6-carboxytetramethylrhodamine). Placentally derived fetal mRNA in the plasma was quantified by one-step real-time quantitative RT-PCR using an assay for corticotropin-releasing hormone (CRH) as described previously (6).
The real-time and RT-PCR reactions were set up according to the manufacturer’s instructions in a reaction volume of 25 µL. Each sample was analyzed in triplicate. For the RT-PCR assay, multiple negative water blanks were included in every analysis. A calibration curve for the quantification of GAPDH mRNA was prepared with serial dilutions of human control RNA (ranging from 15 to 0.23 pg), according to the manufacturer’s instructions (PE Applied Biosystems) and using their estimation that 1 pg of the control RNA contains 100 copies of GAPDH transcript. The RT-PCR assay was carried out by initiating the reaction at 50 °C for 2 min, followed by a reverse transcription step at 48 °C for 30 min. After a 5-min denaturation at 95 °C, the real-time PCR was carried out with 45 of the following cycles: a denaturation step of 94 °C for 15 s and an annealing/extension step of 60 °C for 1 min. All statistical analyses were performed with Sigma Stat software (SPSS), using the paired Student t-test.
The concentration of total DNA was not significantly (P = 0.23) altered by the formaldehyde treatment with the centrifugation protocol of Dhallan et al. (16) (protocols A and B: means = 3248 and 3643 genome-equivalents/mL of plasma, respectively) or with the centrifugation protocol used in our laboratory (protocols C and D: means = 3288 and 3157 genome-equivalents/mL, respectively; P = 0.75; Table 1
and Fig. 1A
).
|
|
Fetal DNA (SRY) concentrations were unaffected by formaldehyde treatment as described by Dhallan et al. (Table 1
and Fig. 1B
). Consequently, we were not able to discern any effect of formaldehyde on the proportion of fetal DNA (Table 1
and Fig. 1C
). For the complete data set, see the Data Supplement that accompanies the online version of this Technical Brief athttp://www.clinchem.org/content/vol51/issue3/.
Formaldehyde treatment did not significantly change the proportion of fetal CRH mRNA and maternal mRNA concentrations in maternal plasma (median proportions of fetal CRH mRNA for protocols A, B, C, and D were 3.5%, 3.2%, 2.9%, and 3.5%, respectively).
Our data therefore do not support the report by Dhallan et al. (16), which stated that formaldehyde treatment led to an increase in the proportion of cell-free fetal DNA in maternal plasma samples of 20–50% or more. The reason for this difference is unclear at present, but it may be attributable to the use of two different approaches to quantifying the proportions of fetal DNA in the maternal plasma samples. Considerable variation in this proportion may exist even when using a standard real-time PCR protocol, as is evident from the recently concluded large-scale National Institute of Child Health and Human Development-funded "NIFTY" study, in which considerable variations in detection sensitivity and quantification of fetal DNA concentrations were noted among laboratories very familiar with real-time PCR technology (21).
Further studies will be needed to clarify this issue in addition to the continued exploration of other strategies for the investigation of complex fetal genetic traits by analysis of maternal plasma. These strategies may include the enrichment of fetal sequences by size-fractionation of plasma DNA (22)(23) or the use of mass spectroscopy (24), which has recently been shown to permit reliable detection of fetal point mutations.
References
-globin gene expression suggests that fetal hematopoietic cells contribute to the pool of circulating cell-free fetal nucleic acids during pregnancy. Clin Chem 2004;50:689-693.The following articles in journals at HighWire Press have cited this article:
|
|
 |
|
  Y. M. Dennis Lo and R. W. K. Chiu Noninvasive Prenatal Diagnosis of Fetal Chromosomal Aneuploidies by Maternal Plasma Nucleic Acid Analysis Clin. Chem., March 1, 2008; 54(3): 461 - 466. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. M. D. Lo, F. M. F. Lun, K. C. A. Chan, N. B. Y. Tsui, K. C. Chong, T. K. Lau, T. Y. Leung, B. C. Y. Zee, C. R. Cantor, and R. W. K. Chiu From the Cover: Digital PCR for the molecular detection of fetal chromosomal aneuploidy PNAS, August 7, 2007; 104(32): 13116 - 13121. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
.