| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Abstracts of Oak Ridge Posters |
(ISEAO Technologies Ltd., London, United Kingdom;
aaddress correspondence to this author at: ISEAO Technologies Ltd., 2 Royal College St., London, NW1 0NH, United Kingdom; fax 44 2076912036, e-mail chris.stanley{at}iseao.co.uk)
Detection of bacterial growth is used in the diagnosis and treatment of infectious disease, blood screening, food safety, product quality assurance, and life science research. The measurement of intracellular ATP content has long been the standard for rapid bacterial growth and viability measurement (1)(2)(3). The current methods used to detect ATP include luminescence generated by the enzyme system firefly luciferase/luciferin. The chemistry involved in this process is simple and can be used with a wide range of luminescence equipment, from handheld devices to sophisticated, laboratory-based instruments for high-throughput applications(4).
We have developed an alternative, quantitative assay method for ATP based on a nucleic acid testing (NAT) format. During the past decade NAT has become the method of choice for bacterial identification (5). NAT hardware, such as thermal cyclers, isothermal instruments, and real-time/kinetic product detection systems, are now commonplace laboratory equipment. The new method, LiMA (Ligase Mediated ATP Amplification Assay)(6), uses DNA ligase, an ATP-requiring enzyme(7), to join 2 oligonucleotides in a nicked-DNA substrate and create a template that can be amplified in a DNA amplification reaction (Fig. 1
). Before the LiMA process, the ligase is treated with pyrophosphate to ensure that all the enzyme molecules are in the deadenylated form. Thus the ligase is inactive until it binds a molecule of ATP, which leads to the loss of the pyrophosphate moiety from ATP and the formation of a covalent enzyme—AMP intermediate linked to a lysine side-chain in the enzyme. In this reaction the enzyme becomes charged by an ATP molecule; essentially, a sample is scavenged for its ATP content. In the next step of the reaction the AMP nucleotide is transferred to the 5' phosphate of the nicked-DNA strand, followed by attack on the AMP-DNA bond by the 3'-OH of the nicked DNA to generate an intact phosphodiester backbone. This product then forms a template for a subsequent DNA amplification process, typically PCR. In this coupled process the catalytic activity of the enzyme is amplified by the NAT process, leading to very high signal generation.
|
A preferred configuration of the LiMA procedure is to immobilize the deadenylated ligase on the surface of a paramagnetic bead. This reagent can then be added to a dilute ATP solution, left to accumulate ATP (in the form of the stable AMP-charged enzyme intermediate), and then concentrated (using a magnet) before detection of ligase activity in the NAT process. This procedure provides additional sensitivity, because it allows much larger sample volumes to be easily measured (>1 mL). A further advantage of the magnetic bead-based approach is that any DNA-amplification inhibitors present in the specimen can be removed by washing before the NAT process. Further improvements in the ATP assay can be achieved by immobilizing both the ligase and the nicked-DNA substrate on the paramagnetic bead to reduce the reagent additions required in the assay. This process also provides further rate enhancement because of the proximity of enzyme and substrate on the bead.
The reagents for the LiMA procedure were prepared and stored at 4 °C before use in the ATP assay. To couple ligase to the solid phase, 500 µL Dynal M270 amine paramagnetic beads were washed in standard PBS (120 mmol/L NaCl, 2.7 mmol/L KCl, 10 mmol/L phosphate buffer, pH 7.4) with a magnetic separation device and activated by incubation with 1 g/L suberic acid hydroxyl succinate ester (Sigma Aldrich) in PBS for 30 min at room temperature (22 °C) with shaking. Meanwhile, 4000 U of T4 DNA ligase (New England Biolabs) were deadenylated for 30 min at room temperature in 50 mmol/L HEPES, pH 7.5, 5 mmol/L sodium pyrophosphate, and 10 mmol/L dithiothreitol (DTT) in a volume of 500 µL. The activated magnetic beads were then washed twice in PBS and once in 50 mmol/L HEPES, pH 7.5, and the deadenylated ligase was added to the washed beads and incubated for 30 min at room temperature with shaking. The immobilized ligase magnetic beads were washed twice in 50 mmol/L HEPES, pH 7.5, 5 mmol/L sodium pyrophosphate, and 10 mmol/L DTT and incubated in 500 µL of this wash solution for 10 min to ensure deadenylation of any remaining active enzyme. Finally the immobilized ligase magnetic beads were washed 5 times with Tris-buffered saline (TBS), 10 mmol/L DTT, 10 mmol/L ethanolamine, and 1 mmol/L MgCl2 and stored in 500 µL of this buffer (ligase buffer) at 4 °C before use. Magnetic beads with both ligase and streptavidin immobilized on the surface were prepared according to the method described above, except that 1 mg of streptavidin (Sigma Aldrich) was added to the deadenylated ligase solution before coupling to the beads. After being washed 3 times with TBS containing 10 mmol/L DTT, 10 mmol/L ethanolamine, and 1 mmol/L MgCl2, 10 ng of the preformed nicked-DNA substrate (for sequences see below) with a 5' biotin moiety was added, incubated for 1 h at 4 °C, and washed 3 times with the TBS buffer above. The ligase/streptavidin/DNA magnetic beads were then stored in ligase buffer at 4 °C. The nicked double-stranded DNA substrate was prepared by heating a mixture containing 10 ng of each of the 3 oligomers to 95 °C for 5 min and cooling to room temperature. The sequences used were as follows: 5'biotinGCCGATATCGGACAACGGCCGAACTGGGAAGGCGCACGGAGAGA3', 5'CCACGAAGTACTAGCTGGCCGTTTGTCACCGACGCCTA3', and 5'TAGTACTTCGTGGTCTCTCCGTGC3'.
In the LiMA procedure for ATP, 25 µL of ligase magnetic beads, prepared as described above, were captured magnetically, and the supernatant liquid was removed. The beads were then resuspended in a 20-µL reaction volume containing serial dilutions of ATP in 0.6x TBS with 1 mmol/L MgCl2 and 10 ng of the preformed nicked-DNA substrate. After 15 min at room temperature to allow ligation, 5 µL of each reaction was analyzed by PCR under standard conditions (each cycle was 94 °C for 10 s, 65 °C for 10 s, and 72 °C for 10 seconds; 40 cycles were performed) with the following PCR primers: 5'GGACAACGGCCGAACTGGGAAGGCG3' and 5'TAGGCGTCGGTGACAAACGGCCAGC3'. The double-stranded DNA intercalator dye SYBR® Green I (Eurogentec) was included in the PCR master mix to detect amplicon generation. The Chromo4 real-time system (MJ Research) was used to measure fluorescence increase in microplate wells. The signal generated in the PCR process was proportional to the amount of ATP present in the sample (Fig. 1
, A and B). The LiMA procedure detection limit for ATP was 0.5 nmol/L (10 fmol) in the sample volume of 20 µL used in the assay, calculated using 2.5x SD on 10 replicates of the zero calibrator). The dynamic range was at least 100 000-fold (to >50 µmol/L).
The LiMA process was used to detect bacteria in culture medium. Staphylococcus aureus ATCC no. 25923 was grown in standard nutrient broth culture medium (Merck) until stationary phase was reached. Bacteria in 100 µL samples from serial dilutions of this culture were lysed by the addition of 10 µL of 0.5 mol/L sodium hydroxide containing 10 mL/L Triton X-100 and heating to 95 °C for 3 min After cooling to room temperature, the mixture was neutralized with 10 µL of 0.5 mol/L hydrochloric acid. In the subsequent LiMA procedure there were 3 main steps: ligation, washing/elution, and PCR detection. In step 1 the lysed bacterial culture samples containing ATP were mixed and incubated for 15 min with 1 mL of ligase/streptavidin DNA magnetic bead reagent. In step 2 the beads were washed 3 times with TBS, the PCR reagent mix was used to resuspend the beads, the mix was heated to 95 °C for 5 min to elute the ligated DNA, and 20 µL of the supernatant was transferred to a microplate well. Step 3 was the PCR process with measurement of increasing fluorescence in the microplate wells over 60 min. The total LiMA procedure time was 85 min. The detection limit ranged from 104 to 105 S. aureus cells (calculated using 2.5x SD on 10 replicates of the zero calibrator). Although LiMA is still at an early stage of development, the performance of this method with viable bacterial cells is comparable to that of the best luminescence systems available.
The LiMA technology allows quantitative measurement of viable bacteria and other ATP-containing samples such as yeast and eukaryotic cells by use of standard NAT instrumentation and reagents. This procedure brings together both species identification and functional (growth-based) analyses on the same highly developed laboratory platform.
Acknowledgments
Grant/funding support: None declared.
Financial disclosures: The authors have shares or share options in ISEAO Technologies Ltd.
References
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
