Clinical Chemistry 54: 1900-1907, 2008.
First published August 14, 2008; 10.1373/clinchem.2008.106542
(Clinical Chemistry. 2008;54:1900-1907.)
© 2008 American Association for Clinical Chemistry, Inc.
|
Molecular Diagnostics and Genetics |
Anchor-Based Fluorescent Amplicon Generation Assays (FLAG) for Real-Time Measurement of Human Cytomegalovirus, Epstein–Barr Virus, and Varicella-Zoster Virus Viral Loads
Alessandro Di Nicola1,
Elisa Ghezzi1,
Federico Gillio1,
Francesco Zerilli2,
Erlet Shehi1,
Diego Maritano1,
Massimo Panizzo1,
Fabrizio Bonelli1 and
Daniel Adlerstein1,a
1 DiaSorin SpA, Saluggia, Italy; 2
Università degli Studi di Milano Bicocca, Milano, Italy.
aAddress correspondence to this author at: Diasorin SpA, Viale Pasteur 10, 20014 Nerviano (Mi), Italy. Fax +39-0331-581547; e-mail daniel.adlerstein{at}diasorin.it.
 |
Abstract
|
|---|
Background: Monitoring the human cytomegalovirus (HCMV), Epstein–Barr virus (EBV), or varicella-zoster virus (VZV) viral load is an important factor in the management of immunosuppressed patients, such as recipients of solid-organ or bone marrow transplants. The advent of real-time PCR technologies has prompted the widespread development of quantitative PCR assays for the detection of viral loads and other diagnostic purposes.
Methods: The fluorescent amplicon generation (FLAG) technology uses the PspGI restriction enzyme to monitor PCR product generation. We modified the FLAG technology by introducing an accessory oligonucleotide "anchor" that stabilizes the binding of the forward primer to the target sequence (a-FLAG). We developed assays for HCMV, EBV, and VZV that incorporated an internal amplification-control reaction to validate negative results and extensively analyzed the performance of the HCMV a-FLAG assay.
Results: The 3 assays performed similarly with respect to reaction efficiency and linear range. Compared with a commercially available kit, the HCMV a-FLAG assay results showed good correlation with calculated concentrations (r = 0.9617), excellent diagnostic sensitivity and specificity (99% and 95%, respectively), and similar values for the linear range (1–107 copies/µL), analytical sensitivity (0.420 copies/µL), and intra- and interassay imprecision.
Conclusions: The a-FLAG assay is an alternative real-time PCR technology suitable for detecting and quantifying target-DNA sequences. For clinical applications such as the measurement of viral load, a-FLAG assays provide multiplex capability, internal amplification control, and high diagnostic sensitivity and specificity.
|
Introduction
|
|---|
The real-time PCR is a powerful tool for the detection and quantification of viral nucleic acids. This method has a number of advantages for routine diagnostics, including multiplex capability, a wide dynamic range, and reduced risks of contamination (1). At present, real-time detection and quantification of target sequences can be achieved with several technologies, such as those incorporating intercalating dyes, probe-based chemistries (such as TaqMan assays), and primer-based chemistries (such as Scorpion probes) (2)(3). For clinical applications, the presence of an internal control sequence that is amplified simultaneously with the target sequence is required to validate negative results (4)(5)(6)(7)(8); hence, the use of real-time multiplex assays is highly recommended.
Measurement of viral load is important for detecting infections caused by herpesviruses, such as human cytomegalovirus (HCMV),1
Epstein–Barr virus (EBV), and varicella-zoster virus (VZV) (9). Infections caused by HCMV, EBV, and VZV have different clinical consequences; however, all can cause critical outcomes in immunocompromised patients (10)(11). Accordingly, highly reliable real-time PCR assays must be used to correctly identify samples that are positive and negative for these viruses (8)(9). Fluorescent amplicon generation (FLAG) was recently described as a primer-based signal-generation technology for detecting mutations (12) and DNA hypermethylation (13). In the present study, we have included an accessory oligonucleotide (an "anchor") in the FLAG assay (a-FLAG). This anchor assists in the binding of the fluorogenic primer by promoting the formation of a highly specific ternary structure, the 3-way junction (14)(15). The formation of the 3-way junction is the initiation event that triggers the amplification reaction. We have adapted a-FLAG for the detection of nucleic acids from 3 viruses (HCMV, EBV, and VZV) in the presence of an internal amplification-control reaction. We compared the performance of the HCMV a-FLAG assay with a commercially available product currently used for detecting and quantifying HCMV in clinical samples.
|
Materials and Methods
|
|---|
source and extraction of hcmv dna
Purified and quantified HCMV, EBV, and VZV genomic DNA was obtained from Advanced Biotechnologies. HCMV DNA concentrations were checked with the artus CMV RG PCR Kit (Qiagen) and with the Q-CMV Real Time Complete Kit (Nanogen Advanced Diagnostics). DNA dilutions were made in 1x Tris-EDTA buffer (10 mmol/L Tris, 1 mmol/L EDTA, pH 8.0) containing 20 ng/µL (20 mg/L) yeast total RNA (Sigma-Aldrich). With informed consent, we obtained samples of HCMV-positive plasma from the Laboratory of Microbiology and Virology, Hospital Maggiore della Carità, Novara, Italy, and extracted viral DNA with the Qiagen QIAamp MinElute Virus Spin Kit according to the manufacturer’s instructions (input volume, 200 µL; output volume, 100 µL).
generation of Pcmv standard plasmid
The exon 4 sequence of HCMV gene UL122 was amplified from purified HCMV DNA with primers AD99 (5'-TTTAAGCTTGGGGCCGGTGCTACTGGAAT-3')and AD100 (5'-TTTCTCGAGATGTGAGCGGGGCATCGAG A-3'). We then digested the 1 512-bp amplicon with HindIII and XhoI (New England Biolabs) and subcloned into pCR2.1 vector (Invitrogen). Plasmid DNA was then purified with the Qiagen QIAfilter Plasmid Midi Kit and quantified by spectrophotometry. Dilutions were prepared in 1x Tris-EDTA buffer (described above) containing 20 ng/µL yeast total RNA. Concentrations were checked with the artus CMV RG PCR Kit and the Q-CMV Real Time Complete Kit according to the manufacturers’ protocols.
generation of internal-control plasmid
We amplified the human β-globin gene (HBB,2
hemoglobin, beta) with primers ES102 (5'-CCCTCTAAGATATATCTCTTGGCC-3') and ES103 (5'-AGAAAAACAACAACAAATGAATGCA-3') and blunt-cloned the 415-bp amplicon into pCR-Blunt vector (Invitrogen). Plasmid DNA was purified with the QIAfilter Plasmid Midi Kit and quantified by spectrophotometry. Dilutions were prepared in 1x Tris-EDTA buffer containing 20 ng/µL yeast total RNA.
target selection and oligonucleotide design
We designed oligonucleotides to amplify DNA regions that do not contain PspGI restriction sites. These regions were within the exon 4 sequence of the UL122 gene of the HCMV AD169 strain (GenBank accession number, NC_001347.3), the BNRF-1 gene of EBV strain B95-8 (accession number, V01555.2), and the UL29 gene of VZV strain Dumas (accession number, X04370). We used Visual OMP software (DNA Software) to check each oligonucleotide for cross-hybridization with any of the other oligonucleotides. Fluorogenic primers were labeled with Iowa Black FQ (IBFQ) and either internal fluorescein (iFluorT) or internal MAX NHS ester (iMAXn). All oligonucleotides were synthesized by Integrated DNA Technologies.
hcmv A-flag assay
The duplex HCMV/HBB assay was performed in a total volume of 40 µL, which contained 1x Tfi buffer (Invitrogen), 2.5 mmol/L MgCl2, 0.025 U/µL Tfi DNA polymerase (Invitrogen), 0.5 U/µL PspGI (New England Biolabs), 1x ACGU dNTP Mix (Sigma-Aldrich), 0.02 U/µL uracil-N-glycosylase (Invitrogen), 60 nmol/L ROX reference dye (Invitrogen), 100 nmol/L ES75QF [HCMV fluorogenic primer: 5'-(IBFQ)TTTCCAGGTT(iFluorT)GAGGCGAGTGTAACGGGCCATCGCCGA-3'], 1 nmol/L ES73d [HCMV anchor: 5'-CTGCTCTCCTAGTGTGGATGACCATCACTCGCCT(3ddC)-3', where 3ddC is 3'-dideoxycytidine], 150 nmol/L ES89 (HCMV reverse primer: 5'-TTTCCAGGTTTAGGTGACACCAGAGAATCAGAGGAGC-3'), 50 nmol/L AD86QR [internal control fluorogenic primer: 5'-(IBFQ)TTTCCAGGTT(iMAXn)GTGTGTGTGGCTAGAACCGAGGTAG-AGTTTTCATCCATT-3'], 1 nmol/L AD84d [internal control anchor: 5'-CCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCTATCCACACACACAA(3ddC)-3'], 75 nmol/L AD70 (internal control reverse primer: 5'-TTTCCAGGTTCACAGCTTGGTAAGCATATTGAAGATCG-3'), 25 fg/µL internal control plasmid, and 20 µL of sample. After a first decontamination step at 50 °C for 2 min and denaturation at 95 °C for 2 min, reactions were performed for 45 cycles of 95 °C for 10 s, 60 °C for 30 s, and 68 °C for 32 s. Reactions were performed in a 7500 Real-Time PCR System (Applied Biosystems). Fluorescence was monitored during the 68 °C step in the FAM and VIC channels; thresholds were set at relative units of 0.05 and 0.02, respectively, with ROX normalization. The baseline was calculated between cycles 6 and 12. All reactions were performed in triplicate except where otherwise indicated. At least 4 calibrators (pCMV) and 1 no-target control were included in each run. Results were considered valid when HCMV amplification occurred before the 45th cycle or when amplification of the internal control occurred between cycles 23–27. Each run was considered valid for quantification if the regression coefficient for the threshold cycles of calibrators was at least 0.990.
ebv A-flag assay
EBV a-FLAG reactions were carried out in the Applied Biosystems 7500 Real-Time PCR System as described for the HCMV a-FLAG assay except that the following EBV-specific oligonucleotides were used: 125 nmol/L EG61QF [EBV fluorogenic primer: 5'-(IBFQ) TTTCCAGGTT(iFluorT)GAGGCGAGTGATCGTGTCCGACTACGGCT-3'], 1 nmol/L EG58d [EBV anchor: 5'-CAGATCGGATTAACCGGTCCATGCTACACTCGCCT(3ddC)-3'], and 125 nmol/L EG30t (EBV reverse primer: 5'-TTTCCAGGTTTCGCATAGCACGGCCACCTGA-3'). All oligonucleotides were synthesized by Integrated DNA Technologies.
vzv A-flag assay
VZV a-FLAG reactions were carried out in the 7500 Real-Time PCR System as described for HCMV a-FLAG assay except that the following VZV-specific oligonucleotides were used: 150 nmol/L FZ1QF [VZV fluorogenic primer: 5'-(IBFQ)TTTCCAGGTT(iFluorT)GAGGCGAGTGTAACCATGGGACGTTGA-3'], 150 nmol/L FZ2d [VZV anchor: 5'-GCCGCTCCGTGATATTTACTAATGCTTATTCCTAAAACATCACTCGCCTC(3ddC)-3'], and 150 nmol/L FZ3 (VZV reverse primer: 5'-TTTCCAGGTTTGCGCTTCTTGAAAAAACGGAAAACTTAC-3'). All oligonucleotides were synthesized by Integrated DNA Technologies.
statistical analysis
Descriptive statistics were calculated with the aid of Microsoft Excel 2000.
|
Results
|
|---|
A-flag reaction
The FLAG system uses the thermostable restriction enzyme PspGI to cleave a fluorophore–quencher pair that is present at the end of double-stranded amplification products (12)(13). In this work, we introduced an accessory oligonucleotide ("anchor") to facilitate the annealing of the forward primer (see Supplemental Figure 1 and Supplemental Table 1 in the Data Supplement that accompanies the online version of this article at http://www.clinchem.org/content/vol54/issue11), which carries at the 5' end an 11-base sequence tag containing a fluorophore–quencher pair separated by a restricted site for PspGI. After an initial denaturation step, the anchor and the fluorogenic primer hybridize to the target DNA to form a 3-way DNA junction (Fig. 1A
). The 3' end of the anchor oligonucleotide is modified with a terminal dideoxycytidine and therefore cannot be extended by the polymerase; the fluorogenic primer, on the other hand, is extended at its 3' end. The opposite strand of the target DNA is bound by an unlabeled reverse primer. To equilibrate the thermodynamic contribution of the accessory sequences in the fluorogenic primer, we added an unlabeled 11-base sequence tag at the 5' end of the reverse primer. In the next cycle of the reaction, the sequence-tag region becomes double-stranded (Fig. 1B
), allowing recognition and cleavage by PspGI and the generation of a fluorescence signal (Fig. 1C
).
View larger version (24K):
[in this window]
[in a new window]
|
Figure 1. a-FLAG principle.
The a-FLAG reaction is summarized in 3 steps. The anchor and the fluorogenic primer hybridize to one strand of the target DNA to form a 3-way DNA junction (step A); the fluorogenic primer carries a sequence tag that contains a fluorophore–quencher pair (F–Q) separated by a restriction site. In the following cycles, the extension of the reverse primer on the first amplification product completes the double-stranded recognition site for PspGI (step B), allowing cleavage and fluorescence generation (step C). Arrows indicate the 3' end of each DNA sequence; the solid dot indicates the terminal dideoxycytidine (ddC).
|
|
A-flag assays for hcmv, ebv, and vzv
a-FLAG assays for HCMV, EBV, and VZV were designed as duplex reactions for the selected viral genomic DNA and for the human HBB gene, which was used as an internal amplification control. We tested serial dilutions of quantified viral DNA with the a-FLAG assay and monitored fluorescence profiles for viral DNA and internal amplification controls in real time (Fig. 2
, A, D, G, B, E, and H). A linear relationship was observed between the measured threshold cycle and the input concentration of viral DNA (Fig. 2
, C, F, and I). The efficiency of viral DNA amplification was calculated from the slope of the regression line, and the 3 assays had similar efficiencies (HCMV, 0.79; EBV, 0.84; VZV, 0.83). As expected, the amplification of the internal control was inversely affected by the target-DNA concentration because of competition for common reagents (Fig. 2
, B, E, and H).
View larger version (38K):
[in this window]
[in a new window]
|
Figure 2. a-FLAG assays for HCMV, EBV, and VZV.
(A–C), serial dilutions of HCMV DNA were analyzed with the a-FLAG assay, which coamplifies the target viral DNA and the internal control sequence. Fluorescence signals, expressed in relative fluorescence units (r.u.) were monitored in real time for the target viral DNA. (A), Open squares, no-target control; solid squares, 2 copies/µL; open diamonds, 20 copies/µL; solid diamonds, 200 copies/µL; open triangles, 2000 copies/µL; solid triangles, 20 000 copies/µL. (B), Internal-control sequence; concentrations as in (A). A single representative profile of 3 replicates is shown for each concentration. (C), The calibration curve was generated by plotting the mean (SD) threshold cycle for viral DNA amplification vs the input concentration of target DNA. (D–F), Experiments identical to those in (A–C) except that EBV DNA was used. (G–I), Experiments identical to those in (A–C) except that VZV DNA was used.
|
|
linear range
To standardize the target DNA used in different experiments, we subcloned the exon 4 sequence of the UL122 gene of HCMV into pCR2.1 vector and used the resulting plasmid (pCMV) for the calibration curves. We quantified pCMV serial dilutions either by spectrophotometry or with 2 reference kits (artus CMV RG PCR Kit, Q-CMV Real Time Complete Kit). To analyze the extent of the linear relationship between the measured signal (threshold cycle) and the initial concentration of target DNA, we tested previously quantified serial dilutions of pCMV standard plasmid (from 5 x 1010 copies/µL to 0.5 copies/µL) in triplicate. We observed a linear relationship (slope, –3.86; r2 = 0.9993) between the mean measured threshold cycle and the logarithm of the input concentration from 5 x 107 copies/µL to 0.5 copies/µL (Fig. 3A
). Because the efficiency calculated for the amplification of pCMV DNA (0.82) was similar to that previously observed for HCMV genomic DNA (0.79), we assumed that pCMV DNA and HCMV DNA were substantially equivalent. We subsequently evaluated the linear range of the assay by quantifying serial dilutions of HCMV DNA from nominal concentrations of 107 copies/µL to 1 copy/µL and observed a linear relationship between expected and calculated concentrations throughout the considered range (slope, 1.02; r = 0.9980; Fig. 3B
). We did not observe significant differences when human genomic DNA solutions (up to 25 ng/µL) were used as the matrix for diluting HCMV DNA (data not shown).
View larger version (15K):
[in this window]
[in a new window]
|
Figure 3. Linear range of the a-FLAG HCMV assay.
(A), Calibration curve obtained by testing serial dilutions of previously quantified pCMV standard plasmid in triplicate (5 x 1010 copies/µL to 0.5 copies/µL). The mean threshold cycle (SD) is plotted vs the input concentration, expressed in log copies/µL. A linear relationship is observed between 5 x 107 copies/µL and 0.5 copies/µL (slope, –3.86; intercept, 38.84; r2 = 0.9993). (B), A linearity test was performed on serial dilutions of HCMV genomic DNA (nominal 107 copies/µL to 1 copy/µL. The calculated concentration (output) is plotted vs the expected concentration (input), expressed in log copies/µL.
|
|
limit of detection
The limit of detection of the assay was defined as the lowest concentration of HCMV DNA at which the assay could distinguish a positive sample from negative samples 95% of the time. We diluted HCMV DNA extracted from a high-titer clinical sample to nominal concentrations of 1–0.001 copies/µL and tested 8 replicates of the dilutions in 3 independent runs. We then plotted the percentage of positive results for each sample against the logarithm of the input concentration and used the best-fitting cumulative standard distribution equation to calculate the concentration corresponding to 95% of the positive results. The calculated concentration was 0.420 copies/µL; that is, the assay was able to detect as few as 8.40 copies of HCMV DNA per reaction 95% of the time (Fig. 4
). Given the extraction procedure used (QIAamp MinElute Virus Spin Kit; input volume, 200 µL; output volume, 100 µL), this value corresponds to a concentration in a clinical sample of 210 copies/mL, assuming a 100% extraction efficiency.
View larger version (17K):
[in this window]
[in a new window]
|
Figure 4. Limit of detection.
HCMV DNA extracted from a high-titer plasma sample was diluted to nominal concentrations of 1 to 0.001 copies/µL and run in 8 replicates in 3 independent runs. The observed percentage of positive results for each sample (solid dots) was plotted against the logarithm of the input concentration. The concentration corresponding to a 95% detection rate (–0.377 log or 0.420 copies/µL, open diamond) was calculated by fitting the cumulative standard distribution equation (r2 = 0.9860, black line).
|
|
reproducibility
Interassay imprecision was analyzed in 20 runs, with a single replicate per run, on 5 samples of HCMV DNA. Intraassay imprecision was analyzed for the same samples in a single run, with 10 replicates (a confirmation experiment was performed). Calculated minimum, maximum, and mean values, the SD, and the CV are presented in Table 1
. As expected, interassay CV values were higher than intraassay CV values. Sample A, which had the lowest concentration of all the analyzed samples (1.5 copies/µL), had the highest observed interassay and intraassay CVs (46.97% and 32.72%, respectively).
comparison of the A-flag hcmv assay with the ARTUS cmv rg pcr kit
We compared the a-FLAG HCMV assay performance and the results for the artus CMV RG PCR Kit by usinga panel of 128 plasma samples previously tested with a third system (Q-CMV Real Time Complete Kit). After extracting viral DNA with the QIAamp MinElute Virus Spin Kit (input volume, 200 µL; output volume, 100 µL), we found that 124 of the 128 samples produced concordant results: 70 of 71 artus-positive samples were positive in the a-FLAG assay (slope of the regression line, 0.991; r = 0.9617; Fig. 5
), resulting in a diagnostic sensitivity of 99%. Similarly, we found 54 of 57 artus-negative samples also to be negative in the a-FLAG assay, resulting in a diagnostic specificity of 95%. Four samples produced discordant results: 1 sample was negative in the a-FLAG assay and positive in the artus method, and 3 samples were positive by the a-FLAG assay and negative in the artus assay. Threshold cycle values for these 4 samples indicated that their concentrations were below the limit of detection of both methods. We excluded the possibility of the presence of inhibitors in the reaction, because all of the discordant samples were validated with the internal amplification control. We also assessed the cross-reactivity of the a-FLAG HCMV assay with a panel of different herpesviruses (EBV; VZV; human herpesviruses 6a, 6b, and 8; herpes simplex viruses types 1 and 2); no cross-reactivity was observed (data not shown).
View larger version (21K):
[in this window]
[in a new window]
|
Figure 5. Comparison of results obtained with the a-FLAG HCMV assay and the artus CMV RG PCR Kit.
Analyses were performed on 70 plasma samples that had previously been tested with a third assay. The samples were extracted with QIAamp MinElute Virus Spin Kit and quantified with the a-FLAG HCMV assay and the artus CMV RG PCR kit. Concentrations are expressed as log copies/µL of HCMV DNA.
|
|
|
Discussion
|
|---|
The usefulness of the diagnostic real-time PCR in virology is well established, because the rate of disease progression has been shown in many viral diseases to be directly related to the amount of viral nucleic acid that can be detected in plasma, serum, or peripheral blood lymphocytes. In immunosuppressed patients, such as recipients of solid-organ or bone marrow transplants, the clinical need to monitor HCMV, EBV, and VZV infections by quantifying the viral DNA in the blood has been well documented (8)(9)(10)(16)(17)(18). The anchor-based FLAG assay presented in this work provides an alternative method for detecting these 3 viruses. This assay combines diagnostic sensitivity with the diagnostic specificity required for clinical applications. We modified the originally described FLAG assay by introducing a third oligonucleotide (the anchor) to ensure a highly specific initiation event for the amplification reaction. This additional oligonucleotide forms a stable heteroduplex with the target DNA (16), enabling the formation of a specific ternary structure with the fluorogenic primer. The resulting 3-way junction (target–anchor–fluorogenic primer, Fig. 1A
) has a calculated 
G° 2 times higher than a regular PCR primer or the fluorogenic primer alone (HCMV 3-way junction, –23.42 kcal/mol; HCMV fluorogenic primer alone, –10.13 kcal/mol; HCMV reverse primer, –12.31 kcal/mol) (see Fig. 1
and Table 1
in the online Data Supplement). The thermodynamic contribution of the anchor allows one to use the primers at lower concentrations, thus reducing the risk of forming primer dimers in samples with negligible or no target DNA (2). Moreover, the cost of the labeled oligonucleotides required for each reaction is reduced.
We developed 3 different assays (for HCMV, EBV, and VZV DNA) that share the same internal amplification-control system and display very similar performances in terms of the efficiency of the reaction. We further evaluated the HCMV a-FLAG assay by calculating the limit of detection, evaluating interassay and intraassay imprecision, and comparing the results with those obtained with the commercially available artus CMV RG PCR Kit. In the absence of an international standard for HCMV DNA quantification (only proficiency panels are available), we decided to assign the titer of our calibrators with the artus CMV RG PCR Kit. The 2 assays showed comparable values with respect to the linear range, the limit of detection, and interassay and intraassay imprecision. The results of our quantification of DNA in the 128 plasma samples obtained with the 2 methods showed a good correlation. We observed discordant results for only 4 samples that had concentrations below the limit of detection of both assays. The internal amplification control allowed us to exclude the presence of PCR inhibitors, because none of the discordant samples had atypical threshold cycle values for the internal control.
These results demonstrate that the a-FLAG technique could be applied to the detection and quantification of HCMV, EBV, and VZV DNA in the presence of an internal amplification control. This and previous work (12)(13) indicate that the FLAG principle could be adapted to develop real-time assays for a wide range of clinical applications.
|
Acknowledgments
|
|---|
Author Contributions: All authors confirmed they have contributed to the intellectual content of this paper and have met the following 3 requirements: (a) significant contributions to the conception and design, acquisition of data, or analysis and interpretation of data; (b) drafting or revising the article for intellectual content; and (c) final approval of the published article.
Authors’ Disclosures of Potential Conflicts of Interest: Upon manuscript submission, all authors completed the Disclosures of Potential Conflict of Interest form. Potential conflicts of interest:
Employment or Leadership: None declared.
Consultant or Advisory Role: None declared.
Stock Ownership: None declared.
Honoraria: None declared.
Research Funding: This work was supported by DiaSorin SpA.
Expert Testimony: None declared.
Role of Sponsor: The funding organizations played no role in the design of study, choice of enrolled patients, review and interpretation of data, or preparation or approval of manuscript.
Acknowledgments: We would like to thank Dr. Mike G. Makrigiorgios for critically reviewing the paper.
|
Footnotes
|
|---|
1 Nonstandard abbreviations: HCMV, human cytomegalovirus (human herpesvirus 5); EBV, Epstein–Barr virus (human herpesvirus 4); VZV, varicella-zoster virus (human herpesvirus 3); FLAG, fluorescent amplicon generation; a-FLAG, modified FLAG in which an accessory oligonucleotide "anchor" stabilizes the binding of the forward primer to the target sequence. 
2 Human genes: HBB, hemoglobin, beta.
|
References
|
|---|
- Niesters HG. Clinical virology in real time. J Clin Virol 2002;25:S3-S12.[Web of Science][Medline]
[Order article via Infotrieve]
- Kubista M, Andrade JM, Bengtsson M, Forootan A, Jonák J, Lind K, et al. The real-time polymerase chain reaction. Mol Aspects Med 2006;27:95-125.[CrossRef][Medline]
[Order article via Infotrieve]
- Li J, Wang F, Mamon H, Kulke MH, Harris L, Maher E, et al. Antiprimer quenching-based real-time PCR and its application to the analysis of clinical cancer samples. Clin Chem 2006;52:624-633.[Abstract/Free Full Text]
- Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE. Multiplex PCR: optimization and application in diagnostic virology. Clin Microbiol Rev 2000;13:559-570.[Abstract/Free Full Text]
- Neumaier M, Braun A, Wagener C. Fundamentals of quality assessment of molecular amplification methods in clinical diagnostics. International Federation of Clinical Chemistry Scientific Division Committee on Molecular Biology Techniques. Clin Chem 1998;44:12-26.[Abstract/Free Full Text]
- Niesters HG. Molecular and diagnostic clinical virology in real time. Clin Microbiol Infect 2004;10:5-11.[CrossRef][Web of Science][Medline]
[Order article via Infotrieve]
- Vernet G. Molecular diagnostics in virology. J Clin Virol 2004;31:239-247.[CrossRef][Web of Science][Medline]
[Order article via Infotrieve]
- Watzinger F, Ebner K, Lion T. Detection and monitoring of virus infections by real-time PCR. Mol Aspects Med 2006;27:254-298.[CrossRef][Medline]
[Order article via Infotrieve]
- Espy MJ, Uhl JR, Sloan LM, Buckwalter SP, Jones MF, Vetter EA, et al. Real-time PCR in clinical microbiology: applications for routine laboratory testing. Clin Microbiol Rev 2006;19:165-256.[Abstract/Free Full Text]
- Kalpoe JS, Kroes AC, Verkerk S, Claas EC, Barge RM, Beersma MF. Clinical relevance of quantitative varicella-zoster virus (VZV) DNA detection in plasma after stem cell transplantation. Bone Marrow Transplant 2006;38:41-46.[CrossRef][Web of Science][Medline]
[Order article via Infotrieve]
- Smith TF, Espy MJ, Mandrekar J, Jones MF, Cockerill FR, Patel R. Quantitative real-time polymerase chain reaction for evaluating DNAemia due to cytomegalovirus, Epstein-Barr virus, and BK virus in solid-organ transplant recipients. Clin Infect Dis 2007;45:1056-1061.[CrossRef][Web of Science][Medline]
[Order article via Infotrieve]
- Amicarelli G, Shehi E, Makrigiorgos GM, Adlerstein D. FLAG assay as a novel method for real-time signal generation during PCR: application to detection and genotyping of KRAS codon 12 mutations. Nucleic Acids Res 2007;35:e131.[Abstract/Free Full Text]
- Bonanno C, Shehi E, Adlerstein D, Makrigiorgos GM. MS-FLAG, a novel real-time signal generation method for methylation-specific PCR. Clin Chem 2007;53:2119-2127.[Abstract/Free Full Text]
- Shlyakhtenko LS, Appella E, Harrington RE, Kutyavin I, Lyubchenko YL. Structure of three-way DNA junctions. 2. Effects of extra bases and mismatches. J Biomol Struct Dyn 1994;12:131-143.[Web of Science][Medline]
[Order article via Infotrieve]
- Amicarelli G, Adlerstein D, Shehi E, Wang F, Makrigiorgos GM. Genotype-specific signal generation based on digestion of 3-way DNA junctions: application to KRAS variation detection. Clin Chem 2006;52:1855-1863.[Abstract/Free Full Text]
- Emery VC, Sabin CA, Cope AV, Gor D, Hassan-Walker AF, Griffiths PD. Application of viral-load kinetics to identify patients who develop cytomegalovirus disease after transplantation. Lancet 2000;355:2032-2036.[CrossRef][Web of Science][Medline]
[Order article via Infotrieve]
- Gärtner BC, Schäfer H, Marggraff K, Eisele G, Schäfer M, Dilloo D, et al. Evaluation of use of Epstein-Barr viral load in patients after allogeneic stem cell transplantation to diagnose and monitor posttransplant lymphoproliferative disease. J Clin Microbiol 2002;40:351-358.[Abstract/Free Full Text]
- Leung TF, Chik KW, Li CK, Lai H, Shing MM, Chan PK, et al. Incidence, risk factors and outcome of varicella-zoster virus infection in children after haematopoietic stem cell transplantation. Bone Marrow Transplant 2000;25:167-172.[CrossRef][Web of Science][Medline]
[Order article via Infotrieve]
Top
Abstract
Introduction
